Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23282
Trapped Gene
Ubtd1 (ENSMUSG00000025171)
Vector Insertion
Chr 19: 42106607 - 42108078
Public Clones not available
Private Clones OST267355 (lexicon) OST128398 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000148508 (Chr19:42106379..42106606 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGAGCAAACGAGATGAGTT Chr19:42106450..42106469 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000148508 (Chr19:42106379..42106606 +)
Downstram Exon
ENSMUSE00000384994 (Chr19:42108079..42109131 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGAGCAAACGAGATGAGTT Chr19:42106450..42106469 60.4 50 CCAGCTCGTCATAGCATTCA Chr19:42108111..42108130 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359283 Chr19:42056253..42056498 ATCCAGGAGCTCTCGATGTC Chr19:42056302..42056321 59.36 55
upstream ENSMUSE00000148508 Chr19:42106379..42106606 CGGAGCAAACGAGATGAGTT Chr19:42106450..42106469 60.4 50

*** Putative Vector Insertion (Chr 19: 42106607 - 42108078) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000384994 Chr19:42108079..42109131 CCAGCTCGTCATAGCATTCA Chr19:42108111..42108130 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACCCTGCCTCATGGTAAG Chr19:42106593..42106613 61.06 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACCCTGCCTCATGGTAAG Chr19:42106593..42106613 61.06 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025171