Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23289
Trapped Gene
Arhgef12 (ENSMUSG00000059495)
Vector Insertion
Chr 9: 42834313 - 42835279
Public Clones not available
Private Clones OST266729 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215813 (Chr9:42835280..42835378 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGAGACAATCCGGTCTTC Chr9:42835299..42835318 59.51 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215813 (Chr9:42835280..42835378 -)
Downstram Exon
ENSMUSE00000516036 (Chr9:42834263..42834312 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGAGACAATCCGGTCTTC Chr9:42835299..42835318 59.51 55 TCACCTGTTTGTACTCCAGCA Chr9:42834254..42834274 59.35 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637640 Chr9:42913262..42913569 GGGGTGTGGAGGTGTTACTG Chr9:42913340..42913359 60.28 60
upstream ENSMUSE00000394931 Chr9:42852347..42852370 No primer for this exon
upstream ENSMUSE00000215815 Chr9:42850674..42850759 TGAACCGAGAGTCACCAACA Chr9:42850726..42850745 60.28 50
upstream ENSMUSE00000215816 Chr9:42848623..42848679 No primer for this exon
upstream ENSMUSE00000215813 Chr9:42835280..42835378 GTGGAGACAATCCGGTCTTC Chr9:42835299..42835318 59.51 55

*** Putative Vector Insertion (Chr 9: 42834313 - 42835279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000516036 Chr9:42834263..42834312 TCACCTGTTTGTACTCCAGCA Chr9:42834254..42834274 59.35 47.62
downstream ENSMUSE00000515168 Chr9:42830898..42830955 No primer for this exon
downstream ENSMUSE00000514142 Chr9:42828688..42828866 GGGAATGAGGGGATGTCATA Chr9:42828716..42828735 59.56 50
downstream ENSMUSE00000474054 Chr9:42826418..42826495 No primer for this exon
downstream ENSMUSE00000473155 Chr9:42826135..42826254 GCCGTTCGGTTGTAATCTTC Chr9:42826204..42826223 59.57 50
downstream ENSMUSE00000472009 Chr9:42823986..42824126 CATCTCCACTGCTCCAGTCA Chr9:42823993..42824012 59.98 55
downstream ENSMUSE00000471036 Chr9:42818262..42818336 GGCTTCCTCCAGGTAACTCC Chr9:42818270..42818289 60.07 60
downstream ENSMUSE00000637583 Chr9:42816099..42816194 TCTGCTCCAATGATGTGAGG Chr9:42816108..42816127 59.79 50
downstream ENSMUSE00000637556 Chr9:42813919..42814029 CAGCAATTCAATGCTCTGGA Chr9:42813966..42813985 59.95 45
downstream ENSMUSE00000584655 Chr9:42813627..42813725 CAGACCGGTCCAAGAAGAAC Chr9:42813607..42813626 59.7 55
downstream ENSMUSE00000584654 Chr9:42809941..42809983 GATCCACGGAGATTTCCTCA Chr9:42809922..42809941 60.01 50
downstream ENSMUSE00000474728 Chr9:42809529..42809634 TGAATGTAGAGGCGATGCAG Chr9:42809561..42809580 59.97 50
downstream ENSMUSE00000637578 Chr9:42809052..42809189 GCTCACTCTCAGCCAAGGTC Chr9:42809127..42809146 60.14 60
downstream ENSMUSE00000637576 Chr9:42808440..42808472 No primer for this exon
downstream ENSMUSE00000637573 Chr9:42808031..42808145 TGCTCCAAGTTTCGAGGTTC Chr9:42808046..42808065 60.38 50
downstream ENSMUSE00000637555 Chr9:42807149..42807254 CCTTTTTCTTCGCCCTCTCT Chr9:42807195..42807214 59.96 50
downstream ENSMUSE00000584640 Chr9:42805657..42805869 GGGAGTGGATAAGTGCTTCG Chr9:42805792..42805811 59.69 55
downstream ENSMUSE00000536102 Chr9:42801072..42801204 GGAGGAGGGAAGTCGAAAAC Chr9:42801092..42801111 60.05 55
downstream ENSMUSE00000536101 Chr9:42800619..42800654 GTTTTGGGGTCCCATGTTCT Chr9:42800607..42800626 60.98 50
downstream ENSMUSE00000536098 Chr9:42799957..42800111 CCAGTTGGGTGGATCTGTCT Chr9:42800008..42800027 59.96 55
downstream ENSMUSE00000637570 Chr9:42798058..42798204 CTTCTCTGGACACTCGCTGA Chr9:42798102..42798121 59.28 55
downstream ENSMUSE00000637554 Chr9:42797043..42797128 TCATTCCTTTTTCGGACAGC Chr9:42797064..42797083 60.19 45
downstream ENSMUSE00000637553 Chr9:42794545..42794670 AGGGCGAAAGGTTGGTTACT Chr9:42794578..42794597 60 50
downstream ENSMUSE00000637567 Chr9:42792457..42792571 CACAGGGGGTTACTCTCAGC Chr9:42792527..42792546 59.72 60
downstream ENSMUSE00000637566 Chr9:42790031..42790131 TCTGCAGCCTTCTTCACCTT Chr9:42790070..42790089 60.13 50
downstream ENSMUSE00000637565 Chr9:42787479..42787556 AGGCGACGCTGATAGTCTTC Chr9:42787509..42787528 59.6 55
downstream ENSMUSE00000637564 Chr9:42786289..42786364 TATTCACCTTCCAGACCAACG Chr9:42786282..42786302 59.98 47.62
downstream ENSMUSE00000637563 Chr9:42785719..42785886 CCGTGCTCAGCTTAATGACA Chr9:42785721..42785740 60.01 50
downstream ENSMUSE00000637562 Chr9:42784116..42784203 CCGTCTGTGCTACCAATTCA Chr9:42784110..42784129 59.72 50
downstream ENSMUSE00000637561 Chr9:42783311..42783397 AGCCATTCGACAGATGAGGT Chr9:42783348..42783367 59.69 50
downstream ENSMUSE00000584636 Chr9:42783116..42783195 GACTTTGCAGACCAGCGACT Chr9:42783097..42783116 60.6 55
downstream ENSMUSE00000584635 Chr9:42782640..42782873 AGAGATGTTCTGCCGCTGAT Chr9:42782759..42782778 59.98 50
downstream ENSMUSE00000584634 Chr9:42780078..42780548 ACGTTACTTGCCTGGCTGTC Chr9:42780235..42780254 60.32 55
downstream ENSMUSE00000584633 Chr9:42779076..42779389 GAATTCTGGGGTGAATGGTG Chr9:42779183..42779202 60.17 50
downstream ENSMUSE00000536083 Chr9:42777796..42777865 No primer for this exon
downstream ENSMUSE00000513860 Chr9:42776453..42777275 GATCCCTCTGTCGCACTCTC Chr9:42777134..42777153 59.95 60
downstream ENSMUSE00000512031 Chr9:42771926..42776264 AGTGTAAGAGGCTGCCTGGA Chr9:42775336..42775355 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAAAGAAGGCAAGGCATTT Chr9:42835267..42835287 59.82 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAAAGAAGGCAAGGCATTT Chr9:42835267..42835287 59.82 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059495