Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23295
Trapped Gene
Arl2bp (ENSMUSG00000031776)
Vector Insertion
Chr 8: 97195281 - 97195961
Public Clones not available
Private Clones OST266506 (lexicon) OST79223 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212888 (Chr8:97195195..97195280 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGTTGCTGGAGCGTATC Chr8:97195223..97195242 60.57 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212888 (Chr8:97195195..97195280 +)
Downstram Exon
ENSMUSE00000212889 (Chr8:97195962..97196058 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGTTGCTGGAGCGTATC Chr8:97195223..97195242 60.57 55 AGCCAGAAAATCCGTGAATG Chr8:97196031..97196050 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394320 Chr8:97190551..97190801 TACGATGGACGCCCTAGAAG Chr8:97190760..97190779 60.23 55
upstream ENSMUSE00000680630 Chr8:97191126..97191130 No primer for this exon
upstream ENSMUSE00000212892 Chr8:97191497..97191558 TTTGATGCTGTGGTTGGATG Chr8:97191519..97191538 60.52 45
upstream ENSMUSE00000212890 Chr8:97194221..97194327 TGCAGAGAAACTTCATGGACA Chr8:97194239..97194259 59.43 42.86
upstream ENSMUSE00000212888 Chr8:97195195..97195280 AGCAGTTGCTGGAGCGTATC Chr8:97195223..97195242 60.57 55

*** Putative Vector Insertion (Chr 8: 97195281 - 97195961) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212889 Chr8:97195962..97196058 AGCCAGAAAATCCGTGAATG Chr8:97196031..97196050 60.07 45
downstream ENSMUSE00000369725 Chr8:97196917..97198317 GGAAGCTGGCGTAGAAGATG Chr8:97197000..97197019 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTATCCCAGGCTTCAACAT Chr8:97195238..97195258 59.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTATCCCAGGCTTCAACAT Chr8:97195238..97195258 59.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031776