Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23296
Trapped Gene
Trim26 (ENSMUSG00000024457)
Vector Insertion
Chr 17: 36974518 - 36987600
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) D151E12 (ggtc) (ggtc) CMHD-GT_536C9-5S (cmhd) CMHD-GT_536C9-3 (cmhd)
IST14161F10 (tigm) IST14813C1 (tigm) IST11554C2 (tigm) IST13056F7 (tigm)
IST12551E1 (tigm) IST12551E1 (tigm) IST15000H3 (tigm)
Private Clones OST266503 (lexicon) OST234894 (lexicon) OST167812 (lexicon) OST143799 (lexicon)
OST85334 (lexicon) OST77694 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000142419 (Chr17:36974410..36974517 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000142419 (Chr17:36974410..36974517 +)
Downstram Exon
ENSMUSE00000142423 (Chr17:36987601..36988073 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGCCGTTCAATGTTCTCCAC Chr17:36987880..36987899 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000142415 Chr17:36974086..36974209 CTGCTTGCTCAGGACCTACC Chr17:36974139..36974158 60.01 60
upstream ENSMUSE00000142419 Chr17:36974410..36974517 No primer for this exon

*** Putative Vector Insertion (Chr 17: 36974518 - 36987600) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142423 Chr17:36987601..36988073 AGCCGTTCAATGTTCTCCAC Chr17:36987880..36987899 60.12 50
downstream ENSMUSE00000142427 Chr17:36988172..36988267 CTTGAAAGCCCTGGATTTTG Chr17:36988238..36988257 59.68 45
downstream ENSMUSE00000358341 Chr17:36989408..36989638 GCTCGGAGATGACCAGAGTC Chr17:36989600..36989619 59.95 60
downstream ENSMUSE00000696655 Chr17:36991229..36991246 No primer for this exon
downstream ENSMUSE00000543796 Chr17:36991570..36991656 GCAGGAGGCAATAGGAACAG Chr17:36991635..36991654 59.84 55
downstream ENSMUSE00000142417 Chr17:36993147..36993169 No primer for this exon
downstream ENSMUSE00000142421 Chr17:36993601..36993716 GGCTTTCCCAATCCAGAACT Chr17:36993637..36993656 60.44 50
downstream ENSMUSE00000142425 Chr17:36993934..36993966 No primer for this exon
downstream ENSMUSE00000478931 Chr17:36994345..36996325 GTGAAGGTGGTCGTGAAGGT Chr17:36994966..36994985 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGCACGAAAACAAAAACA Chr17:36986504..36986524 59.75 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGCACGAAAACAAAAACA Chr17:36986504..36986524 59.75 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024457