Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI233
Trapped Gene
Fstl1 (ENSMUSG00000022816)
Vector Insertion
Chr 16: 37777437 - 37814242
Public Clones GC0681 (tigem) (sanger) G052H05 (ggtc) (ggtc) P086F08 (ggtc)
P072G09 (ggtc) P086B03 (ggtc) P084B02 (ggtc) IST11552E12 (tigm) IST10762C12 (tigm)
IST10046H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700500 (Chr16:37777380..37777436 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700500 (Chr16:37777380..37777436 +)
Downstram Exon
ENSMUSE00000700483 (Chr16:37814243..37814292 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACAATTCCAGTGGCCTCTTC Chr16:37814267..37814286 59.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700502 Chr16:37777141..37777238 CCCACCTTCGCCTCTAACTC Chr16:37777170..37777189 61.14 60
upstream ENSMUSE00000700500 Chr16:37777380..37777436 No primer for this exon

*** Putative Vector Insertion (Chr 16: 37777437 - 37814242) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700483 Chr16:37814243..37814292 ACAATTCCAGTGGCCTCTTC Chr16:37814267..37814286 59.14 50
downstream ENSMUSE00000700481 Chr16:37815586..37815589 No primer for this exon
downstream ENSMUSE00000130721 Chr16:37815792..37815896 TTCTCTGTGACGGCACATTC Chr16:37815871..37815890 59.84 50
downstream ENSMUSE00000321265 Chr16:37818990..37819119 ACACAGGCCTCTTGTGAGGT Chr16:37819020..37819039 59.76 55
downstream ENSMUSE00000130720 Chr16:37821242..37821274 GCAGATGGACTCGCAGACTT Chr16:37821269..37821288 60.56 55
downstream ENSMUSE00000130716 Chr16:37822687..37822817 CTCATCGCGGTTAGCTTGAT Chr16:37822718..37822737 60.37 50
downstream ENSMUSE00000130715 Chr16:37826812..37826930 TGATGGCTGTTTCATTCTGC Chr16:37826890..37826909 59.81 45
downstream ENSMUSE00000130719 Chr16:37828793..37828905 AGTTCAATGAGGGCGTCAAC Chr16:37828825..37828844 60.12 50
downstream ENSMUSE00000130710 Chr16:37829200..37829310 GCATAGGTTTCGTCCTCCAG Chr16:37829230..37829249 59.69 55
downstream ENSMUSE00000130707 Chr16:37831643..37831719 GTCTGGACCCCCTTCTGATT Chr16:37831670..37831689 60.31 55
downstream ENSMUSE00000643780 Chr16:37833968..37836602 ACAGGAGCAGCTAAGGACCA Chr16:37835153..37835172 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGGCCTAGCTCAACCTTGC Chr16:37801399..37801419 59.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGGCCTAGCTCAACCTTGC Chr16:37801399..37801419 59.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022816