Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23303
Trapped Gene
Ccpg1 (ENSMUSG00000034563)
Vector Insertion
Chr 9: 72846952 - 72847269
Public Clones not available
Private Clones OST266275 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217684 (Chr9:72846831..72846951 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCCGTTCTTTATGTAGGG Chr9:72846919..72846938 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217684 (Chr9:72846831..72846951 +)
Downstram Exon
ENSMUSE00000217690 (Chr9:72847270..72847346 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCCGTTCTTTATGTAGGG Chr9:72846919..72846938 59.95 50 TCCCACTGACGATGTGTTGT Chr9:72847304..72847323 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000217685 Chr9:72833385..72833480 TTTTTATGAGGCGTCACTGG Chr9:72833394..72833413 58.77 45
upstream ENSMUSE00000217687 Chr9:72845209..72845277 GACAGCGACTCATCTTGTGG Chr9:72845236..72845255 59.42 55
upstream ENSMUSE00000217684 Chr9:72846831..72846951 TGCCCGTTCTTTATGTAGGG Chr9:72846919..72846938 59.95 50

*** Putative Vector Insertion (Chr 9: 72846952 - 72847269) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217690 Chr9:72847270..72847346 TCCCACTGACGATGTGTTGT Chr9:72847304..72847323 60.01 50
downstream ENSMUSE00000307246 Chr9:72849484..72849682 GGGCGCTTCTTGAATTGTAA Chr9:72849618..72849637 60.21 45
downstream ENSMUSE00000423253 Chr9:72853448..72853699 CTGGTGTCATCGCTACTGGA Chr9:72853499..72853518 59.85 55
downstream ENSMUSE00000423250 Chr9:72858104..72858219 CAGCTCATCTTCGTGGGTCT Chr9:72858159..72858178 60.41 55
downstream ENSMUSE00000307195 Chr9:72859737..72860799 TTTTCAGTTGCCGCTTCTTT Chr9:72860596..72860615 60 40
downstream ENSMUSE00000423265 Chr9:72859737..72861133 TTTTCAGTTGCCGCTTCTTT Chr9:72860596..72860615 60 40
downstream ENSMUSE00000583982 Chr9:72863139..72863798 ACTGCCCCAGTTCTAGCTCA Chr9:72863308..72863327 60.01 55
downstream ENSMUSE00000695934 Chr9:72863139..72863798 ACTGCCCCAGTTCTAGCTCA Chr9:72863308..72863327 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGAGATGGGGGTGTCTAA Chr9:72846986..72847006 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCATGGAGGTGAAGGTAAG Chr9:72846938..72846958 59.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034563