Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23310
Trapped Gene
Clk4 (ENSMUSG00000020385)
Vector Insertion
Chr 11: 51080672 - 51080834
Public Clones not available
Private Clones OST265954 (lexicon) OST189243 (lexicon) OST135803 (lexicon) OST111804 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716252 (Chr11:51080673..51080833 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716252 (Chr11:51080673..51080833 +)
Downstram Exon
ENSMUSE00000720774 (Chr11:51080673..51080833 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386953 Chr11:51076673..51076771 No primer for this exon
upstream ENSMUSE00000679074 Chr11:51076688..51076771 No primer for this exon

*** Putative Vector Insertion (Chr 11: 51080672 - 51080834) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000716252 Chr11:51080673..51080833 No primer for this exon
downstream ENSMUSE00000720774 Chr11:51080673..51080833 No primer for this exon
downstream ENSMUSE00000579994 Chr11:51081667..51081733 No primer for this exon
downstream ENSMUSE00000579993 Chr11:51082271..51082348 No primer for this exon
downstream ENSMUSE00000579992 Chr11:51084039..51084097 No primer for this exon
downstream ENSMUSE00000653790 Chr11:51085302..51085524 No primer for this exon
downstream ENSMUSE00000679073 Chr11:51085302..51085524 No primer for this exon
downstream ENSMUSE00000679080 Chr11:51085302..51085524 No primer for this exon
downstream ENSMUSE00000653788 Chr11:51086580..51086670 No primer for this exon
downstream ENSMUSE00000679079 Chr11:51086580..51086670 No primer for this exon
downstream ENSMUSE00000679068 Chr11:51086953..51087128 No primer for this exon
downstream ENSMUSE00000591329 Chr11:51087062..51087128 No primer for this exon
downstream ENSMUSE00000716205 Chr11:51087062..51087128 No primer for this exon
downstream ENSMUSE00000716691 Chr11:51087062..51087128 No primer for this exon
downstream ENSMUSE00000721217 Chr11:51087062..51087128 No primer for this exon
downstream ENSMUSE00000104031 Chr11:51088713..51088829 No primer for this exon
downstream ENSMUSE00000591328 Chr11:51088713..51088829 No primer for this exon
downstream ENSMUSE00000104032 Chr11:51088914..51089080 No primer for this exon
downstream ENSMUSE00000591327 Chr11:51088914..51089080 No primer for this exon
downstream ENSMUSE00000579986 Chr11:51089272..51089366 No primer for this exon
downstream ENSMUSE00000591326 Chr11:51089272..51089366 No primer for this exon
downstream ENSMUSE00000579985 Chr11:51089620..51089749 No primer for this exon
downstream ENSMUSE00000591325 Chr11:51089620..51089749 No primer for this exon
downstream ENSMUSE00000104029 Chr11:51091355..51091437 No primer for this exon
downstream ENSMUSE00000591324 Chr11:51091355..51091437 No primer for this exon
downstream ENSMUSE00000104030 Chr11:51093860..51093939 No primer for this exon
downstream ENSMUSE00000591323 Chr11:51093860..51093939 No primer for this exon
downstream ENSMUSE00000104047 Chr11:51094611..51094701 No primer for this exon
downstream ENSMUSE00000591322 Chr11:51094611..51094701 No primer for this exon
downstream ENSMUSE00000515553 Chr11:51094779..51095265 No primer for this exon
downstream ENSMUSE00000591321 Chr11:51094779..51094906 No primer for this exon
downstream ENSMUSE00000679070 Chr11:51094779..51095268 No primer for this exon
downstream ENSMUSE00000679084 Chr11:51094779..51095266 No primer for this exon
downstream ENSMUSE00000706079 Chr11:51094779..51095265 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCATTCCAAACGAACTCAC Chr11:51080678..51080698 60.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCATTCCAAACGAACTCAC Chr11:51080678..51080698 60.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020385