Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2332
Trapped Gene
AC163298.4 (ENSMUSG00000079490)
Vector Insertion
Chr 16: 98218602 - 98229793
Public Clones AD0935 (sanger) RRS509 (baygenomics) XK416 (baygenomics)
Private Clones OST431329 (lexicon) OST258014 (lexicon) OST139618 (lexicon) OST81593 (lexicon)
OST60902 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696813 (Chr16:98218529..98218601 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTTGGATGCTGTGGATTGT Chr16:98218553..98218572 60.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696813 (Chr16:98218529..98218601 +)
Downstram Exon
ENSMUSE00000696811 (Chr16:98229794..98229920 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTTGGATGCTGTGGATTGT Chr16:98218553..98218572 60.79 50 GCACATCATCATGGGTCAAC Chr16:98229821..98229840 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696813 Chr16:98218529..98218601 GGTTGGATGCTGTGGATTGT Chr16:98218553..98218572 60.79 50

*** Putative Vector Insertion (Chr 16: 98218602 - 98229793) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696811 Chr16:98229794..98229920 GCACATCATCATGGGTCAAC Chr16:98229821..98229840 59.78 50
downstream ENSMUSE00000696809 Chr16:98230109..98230169 No primer for this exon
downstream ENSMUSE00000696807 Chr16:98236831..98236884 TTCAGCCAGTCCTGGATACC Chr16:98236862..98236881 60.07 55
downstream ENSMUSE00000696806 Chr16:98237007..98237918 CAGACTGTGAAGGGTGAGCA Chr16:98237389..98237408 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGATTTTAATCGCCTTGCAG Chr16:98218646..98218667 59.73 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGGAATGAAATGAGAAGCATT Chr16:98218562..98218585 59.96 30.43 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079490