Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23329
Trapped Gene
Krtcap2 (ENSMUSG00000042747)
Vector Insertion
Chr 3: 89050438 - 89050699
Public Clones not available
Private Clones OST263920 (lexicon)
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376450 (Chr3:89050182..89050437 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCGCGTAGAGGAAGAAGTA Chr3:89050312..89050331 59.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376450 (Chr3:89050182..89050437 +)
Downstram Exon
ENSMUSE00000310340 (Chr3:89050700..89050854 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCGCGTAGAGGAAGAAGTA Chr3:89050312..89050331 59.62 55 TCAGGGAGAAGACGAAAAGG Chr3:89050855..89050874 59.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376450 Chr3:89050182..89050437 GGCGCGTAGAGGAAGAAGTA Chr3:89050312..89050331 59.62 55

*** Putative Vector Insertion (Chr 3: 89050438 - 89050699) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310340 Chr3:89050700..89050854 TCAGGGAGAAGACGAAAAGG Chr3:89050855..89050874 59.4 50
downstream ENSMUSE00000310335 Chr3:89050987..89051050 GCTTGGAAGCCTTTACCAAA Chr3:89051036..89051055 59.34 45
downstream ENSMUSE00000310326 Chr3:89052996..89053062 GACACAAACTCGGTGGATGA Chr3:89053057..89053076 59.53 50
downstream ENSMUSE00000380177 Chr3:89053493..89053644 TGTTGCCTGGTACAGAGTGG Chr3:89053562..89053581 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCTTTCTCCAGGGACAC Chr3:89050391..89050411 61.02 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTCTTTCTCCAGGGACAC Chr3:89050391..89050411 61.02 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042747