Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23334
Trapped Gene
Ppib (ENSMUSG00000032383)
Vector Insertion
Chr 9: 65910890 - 65913293
Public Clones not available
Private Clones OST263399 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000532521 (Chr9:65910796..65910889 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGATCCAGGGTGGAGACT Chr9:65910846..65910865 59.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000532521 (Chr9:65910796..65910889 +)
Downstram Exon
ENSMUSE00000532520 (Chr9:65913294..65913478 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGATCCAGGGTGGAGACT Chr9:65910846..65910865 59.92 55 AACTTTGCCGAAAACCACAT Chr9:65913469..65913488 59.48 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219272 Chr9:65908062..65908207 AGCGCAATATGAAGGTGCTC Chr9:65908089..65908108 60.38 50
upstream ENSMUSE00000471832 Chr9:65909274..65909387 TCGTCTTTGGACTCTTTGGAA Chr9:65909317..65909337 59.84 42.86
upstream ENSMUSE00000532521 Chr9:65910796..65910889 CATGATCCAGGGTGGAGACT Chr9:65910846..65910865 59.92 55

*** Putative Vector Insertion (Chr 9: 65910890 - 65913293) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000532520 Chr9:65913294..65913478 AACTTTGCCGAAAACCACAT Chr9:65913469..65913488 59.48 40
downstream ENSMUSE00000357201 Chr9:65914102..65914428 TGGCTACCTTCGTCTGTGTG Chr9:65914304..65914323 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr9:65910938..65910958 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGATGGCACAGGAGGTAA Chr9:65910875..65910895 60.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032383