Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23335
Trapped Gene
Pgm1 (ENSMUSG00000029171)
Vector Insertion
Chr 5: 64507673 - 64519015
Public Clones IST10548E2 (tigm)
Private Clones OST263398 (lexicon) OST76850 (lexicon) OST17288 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000544997 (Chr5:64507539..64507672 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAAATGATCACCTTCACC Chr5:64507561..64507580 60.33 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000544997 (Chr5:64507539..64507672 +)
Downstram Exon
ENSMUSE00000544995 (Chr5:64519016..64519395 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAAATGATCACCTTCACC Chr5:64507561..64507580 60.33 50 GTTCTTCAATGGCACCGACT Chr5:64519074..64519093 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000545005 Chr5:64484189..64484327 GAAGGCAGTGGCTTGGGTAT Chr5:64484259..64484278 61.4 55
upstream ENSMUSE00000186555 Chr5:64488218..64488385 TGACCTGACCATCATCCAGA Chr5:64488358..64488377 60.05 50
upstream ENSMUSE00000455536 Chr5:64492186..64492292 TTCAGTGACCTGAAGCAGAGG Chr5:64492213..64492233 60.57 52.38
upstream ENSMUSE00000186557 Chr5:64494093..64494177 GCTGCGACTGCATTTATCAC Chr5:64494106..64494125 59.45 50
upstream ENSMUSE00000599294 Chr5:64494616..64494699 GTGTCGCACCTGAAACTCTG Chr5:64494625..64494644 59.47 55
upstream ENSMUSE00000257845 Chr5:64494953..64495146 TCAGGCCATTGAGGAAAATC Chr5:64495006..64495025 60.01 45
upstream ENSMUSE00000186542 Chr5:64496994..64497183 GGAGAGCAAGGTGAAGTTCG Chr5:64497006..64497025 59.99 55
upstream ENSMUSE00000186546 Chr5:64497847..64497944 CCTAGCCAATGACCCAGATG Chr5:64497891..64497910 60.47 55
upstream ENSMUSE00000186551 Chr5:64498908..64499088 TGTTCTCAGGCAATGAGCTG Chr5:64498922..64498941 60.14 50
upstream ENSMUSE00000186541 Chr5:64499409..64499502 TTAACCGGCTTCAAGTGGAT Chr5:64499415..64499434 59.57 45
upstream ENSMUSE00000186538 Chr5:64501755..64501884 TGTGCTGTCCCTTTGTTCTG Chr5:64501761..64501780 59.87 50
upstream ENSMUSE00000186536 Chr5:64503247..64503436 TGATCAGGGCACAATTCAAA Chr5:64503289..64503308 60.05 40
upstream ENSMUSE00000544997 Chr5:64507539..64507672 GCCAAATGATCACCTTCACC Chr5:64507561..64507580 60.33 50

*** Putative Vector Insertion (Chr 5: 64507673 - 64519015) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000544995 Chr5:64519016..64519395 GTTCTTCAATGGCACCGACT Chr5:64519074..64519093 60.12 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCAACAGGTATGACATCG Chr5:64510665..64510685 60.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCAACAGGTATGACATCG Chr5:64510665..64510685 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029171