Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23338
Trapped Gene
Higd1a (ENSMUSG00000038412)
Vector Insertion
Chr 9: 121761728 - 121766629
Public Clones IST14431E12 (tigm)
Private Clones OST263162 (lexicon) OST136105 (lexicon) OST90887 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000460988 (Chr9:121766630..121766722 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000460988 (Chr9:121766630..121766722 -)
Downstram Exon
ENSMUSE00000406807 (Chr9:121761609..121761727 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GACCCCTGACCTTCATCGTA Chr9:121761631..121761650 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000460988 Chr9:121766630..121766722 No primer for this exon

*** Putative Vector Insertion (Chr 9: 121761728 - 121766629) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000406807 Chr9:121761609..121761727 GACCCCTGACCTTCATCGTA Chr9:121761631..121761650 59.93 55
downstream ENSMUSE00000688123 Chr9:121759306..121759440 ACACGCATGTGGATCAAGTG Chr9:121759322..121759341 60.6 50
downstream ENSMUSE00000364583 Chr9:121758657..121758807 TTGGCCCAGAATTCCTGATA Chr9:121758749..121758768 60.4 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAAGAGTTAACTGGGGAAAA Chr9:121763649..121763671 59.04 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCAAGAGTTAACTGGGGAAAA Chr9:121763649..121763671 59.04 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAAGAGGACCTCCCAGAGGA Chr9:121763697..121763717 60.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACAGACCTGCAACGTGACTG Chr9:121763664..121763684 59.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038412