Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23368
Trapped Gene
Gins1 (ENSMUSG00000027454)
Vector Insertion
Chr 2: 150738582 - 150741871
Public Clones not available
Private Clones OST262099 (lexicon) OST237239 (lexicon) OST60550 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000169710 (Chr2:150738517..150738581 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGACTCAGACAAGTTCTGGA Chr2:150738522..150738542 60.43 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000169710 (Chr2:150738517..150738581 +)
Downstram Exon
ENSMUSE00000169709 (Chr2:150741872..150741970 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGACTCAGACAAGTTCTGGA Chr2:150738522..150738542 60.43 52.38 GTATCAGATCCCCTCGTCCA Chr2:150741912..150741931 59.89 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000169711 Chr2:150735337..150735529 AGCTTGTCCGCGAGTTACAC Chr2:150735477..150735496 60.46 55
upstream ENSMUSE00000169710 Chr2:150738517..150738581 CGGACTCAGACAAGTTCTGGA Chr2:150738522..150738542 60.43 52.38

*** Putative Vector Insertion (Chr 2: 150738582 - 150741871) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000169709 Chr2:150741872..150741970 GTATCAGATCCCCTCGTCCA Chr2:150741912..150741931 59.89 55
downstream ENSMUSE00000286041 Chr2:150743605..150743695 CCCATATTCCCACCTGAGTG Chr2:150743653..150743672 60.19 55
downstream ENSMUSE00000385793 Chr2:150751618..150751734 GTGTGATGTCCAAGCCTTCA Chr2:150751702..150751721 59.68 50
downstream ENSMUSE00000595309 Chr2:150753778..150753852 AGCAGGACTGAAGTGCCATC Chr2:150753839..150753858 60.42 55
downstream ENSMUSE00000595308 Chr2:150756577..150757014 TCCAGTGAGGACGTTTCCTT Chr2:150756718..150756737 59.7 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:150741633..150741653 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAAACGTGACTGGGAAAACC Chr2:150741628..150741649 58.98 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027454