Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23380
Trapped Gene
Rpl30 (ENSMUSG00000058600)
Vector Insertion
Chr 15: 34372536 - 34372779
Public Clones not available
Private Clones OST261676 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683731 (Chr15:34372780..34372832 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACCTAAGGCAGGAAGATG Chr15:34372798..34372817 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683731 (Chr15:34372780..34372832 -)
Downstram Exon
ENSMUSE00000496028 (Chr15:34372390..34372535 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACCTAAGGCAGGAAGATG Chr15:34372798..34372817 59.84 55 CCAGCACGTACTTCCCACTT Chr15:34372447..34372466 60.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683726 Chr15:34372940..34373395 GCAACCAACTACCGCAGACT Chr15:34373085..34373104 60.32 55
upstream ENSMUSE00000683733 Chr15:34372940..34372981 No primer for this exon
upstream ENSMUSE00000518487 Chr15:34372780..34372977 GGTGTTTGACGCTCTGGATT Chr15:34372866..34372885 60.12 50
upstream ENSMUSE00000683731 Chr15:34372780..34372832 GCACCTAAGGCAGGAAGATG Chr15:34372798..34372817 59.84 55
upstream ENSMUSE00000719965 Chr15:34372780..34372832 GCACCTAAGGCAGGAAGATG Chr15:34372798..34372817 59.84 55

*** Putative Vector Insertion (Chr 15: 34372536 - 34372779) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496028 Chr15:34372390..34372535 CCAGCACGTACTTCCCACTT Chr15:34372447..34372466 60.17 55
downstream ENSMUSE00000640394 Chr15:34370987..34371117 TGATGGACCCCAGTTTTAGC Chr15:34371045..34371064 59.93 50
downstream ENSMUSE00000493387 Chr15:34370984..34371117 TGATGGACCCCAGTTTTAGC Chr15:34371045..34371064 59.93 50
downstream ENSMUSE00000494412 Chr15:34370265..34370359 CAGTCTGTTCTGGCATGCTT Chr15:34370299..34370318 59.04 50
downstream ENSMUSE00000487278 Chr15:34370260..34370359 CAGTCTGTTCTGGCATGCTT Chr15:34370299..34370318 59.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGAGAGCTGGGTTAATCG Chr15:34372722..34372742 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTAAGGCAGGAAGATGGTG Chr15:34372793..34372813 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058600