Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23383
Trapped Gene
0610006I08Rik (ENSMUSG00000075043)
Vector Insertion
Chr 19: 8845806 - 8846537
Public Clones IST15004D11 (tigm)
Private Clones OST261581 (lexicon) OST6262 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000234339 (Chr19:8845496..8845805 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCACCTTTTGTCTGTGCT Chr19:8845529..8845548 59.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000234339 (Chr19:8845496..8845805 +)
Downstram Exon
ENSMUSE00000144051 (Chr19:8846538..8846965 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCACCTTTTGTCTGTGCT Chr19:8845529..8845548 59.91 50 CGCACAGATCGGAGTGAGTA Chr19:8846589..8846608 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000234339 Chr19:8845496..8845805 AGCCACCTTTTGTCTGTGCT Chr19:8845529..8845548 59.91 50

*** Putative Vector Insertion (Chr 19: 8845806 - 8846537) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000144051 Chr19:8846538..8846965 CGCACAGATCGGAGTGAGTA Chr19:8846589..8846608 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGCTCACTAATCGCCTTG Chr19:8845848..8845868 60.41 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACCGTGACTGGGAAAACC Chr19:8845853..8845873 63.24 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075043