Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23390
Trapped Gene
Map3k7ip3 (ENSMUSG00000035476)
Vector Insertion
Chr X: 82820950 - 82854728
Public Clones not available
Private Clones OST261281 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000623246 (ChrX:82820889..82820949 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTGGAGCAAAGTGAGCTG ChrX:82820907..82820926 60.17 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000623246 (ChrX:82820889..82820949 +)
Downstram Exon
ENSMUSE00000623245 (ChrX:82854729..82854923 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTGGAGCAAAGTGAGCTG ChrX:82820907..82820926 60.17 50 TGCCAGAGTCAATGTTGGTC ChrX:82854825..82854844 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000623247 ChrX:82819361..82819504 No primer for this exon
upstream ENSMUSE00000623246 ChrX:82820889..82820949 TGTTGGAGCAAAGTGAGCTG ChrX:82820907..82820926 60.17 50

*** Putative Vector Insertion (Chr X: 82820950 - 82854728) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000623245 ChrX:82854729..82854923 TGCCAGAGTCAATGTTGGTC ChrX:82854825..82854844 59.68 50
downstream ENSMUSE00000303515 ChrX:82859310..82860768 GTTTGCCTGCTGTATGCTGA ChrX:82859556..82859575 60.02 50
downstream ENSMUSE00000303508 ChrX:82861713..82861873 CTTCAGCTTTCAACCGCTCT ChrX:82861805..82861824 59.76 50
downstream ENSMUSE00000303502 ChrX:82866893..82866986 GGAGTTGTCTGTTCGTGCTTC ChrX:82866937..82866957 59.91 52.38
downstream ENSMUSE00000303494 ChrX:82869681..82869764 TTTTAGATGGCTTCGGTGGT ChrX:82869764..82869783 59.57 45
downstream ENSMUSE00000623244 ChrX:82873499..82873600 TCTACTGGCGCTTTGGAAGT ChrX:82873571..82873590 60.01 50
downstream ENSMUSE00000303468 ChrX:82875745..82879653 TGGACAATTGGTGCTGTTGT ChrX:82879575..82879594 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTGCCTTGTGTTCCAGAAA ChrX:82823968..82823989 59.77 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTATTCGTGACTGGGAAAACC ChrX:82823996..82824017 58.42 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035476