Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23393
Trapped Gene
Unc50 (ENSMUSG00000026111)
Vector Insertion
Chr 1: 37487339 - 37488137
Public Clones (sanger)
Private Clones OST261206 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000350122 (Chr1:37487015..37487338 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGGAATCGCAGGATTAGA Chr1:37487297..37487316 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000350122 (Chr1:37487015..37487338 +)
Downstram Exon
ENSMUSE00000155855 (Chr1:37488138..37488421 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGGAATCGCAGGATTAGA Chr1:37487297..37487316 60.04 50 CAAAGTCCATCTGCCGAAAT Chr1:37488283..37488302 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000350122 Chr1:37487015..37487338 GTGGGAATCGCAGGATTAGA Chr1:37487297..37487316 60.04 50
upstream ENSMUSE00000701079 Chr1:37487042..37487127 No primer for this exon
upstream ENSMUSE00000715814 Chr1:37487047..37487272 No primer for this exon

*** Putative Vector Insertion (Chr 1: 37487339 - 37488137) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000155855 Chr1:37488138..37488421 CAAAGTCCATCTGCCGAAAT Chr1:37488283..37488302 60.07 45
downstream ENSMUSE00000712178 Chr1:37488138..37488421 CAAAGTCCATCTGCCGAAAT Chr1:37488283..37488302 60.07 45
downstream ENSMUSE00000155857 Chr1:37489396..37489516 AAAAATCCCATGTCCAGCAC Chr1:37489441..37489460 59.8 45
downstream ENSMUSE00000155852 Chr1:37494007..37494146 CTGGCGTTTCACCAGGTACT Chr1:37494043..37494062 60.17 55
downstream ENSMUSE00000155854 Chr1:37494222..37494323 AGCCAACAGCAATCAACCAT Chr1:37494293..37494312 60.53 45
downstream ENSMUSE00000367039 Chr1:37495527..37495969 GAGGTGCGAATGGATAGAGC Chr1:37495580..37495599 59.8 55
downstream ENSMUSE00000701076 Chr1:37495527..37495829 GAGGTGCGAATGGATAGAGC Chr1:37495580..37495599 59.8 55
downstream ENSMUSE00000709901 Chr1:37495527..37495832 GAGGTGCGAATGGATAGAGC Chr1:37495580..37495599 59.8 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGGAATCGCAGGATTAGA Chr1:37487298..37487318 60.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGGAATCGCAGGATTAGA Chr1:37487298..37487318 60.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026111