Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2343
Trapped Gene
Tfdp1 (ENSMUSG00000038482)
Vector Insertion
Chr 8: 13339740 - 13357042
Public Clones AD0723 (sanger) CSE125 (baygenomics) RRS235 (baygenomics) CSI664 (baygenomics)
CSE052 (baygenomics) RRN152 (baygenomics) CSE124 (baygenomics) RRY261 (baygenomics)
RRI398 (baygenomics) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000469325 (Chr8:13339665..13339739 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGTGGAGGGTACGCAGTT Chr8:13339680..13339699 60.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000469325 (Chr8:13339665..13339739 +)
Downstram Exon
ENSMUSE00000455008 (Chr8:13357043..13357109 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGTGGAGGGTACGCAGTT Chr8:13339680..13339699 60.71 55 TTAGTTCTCCGTTGGCTTCAA Chr8:13357075..13357095 59.87 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610192 Chr8:13338806..13338920 No primer for this exon
upstream ENSMUSE00000469325 Chr8:13339665..13339739 TCTGTGGAGGGTACGCAGTT Chr8:13339680..13339699 60.71 55

*** Putative Vector Insertion (Chr 8: 13339740 - 13357042) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000455008 Chr8:13357043..13357109 TTAGTTCTCCGTTGGCTTCAA Chr8:13357075..13357095 59.87 42.86
downstream ENSMUSE00000455017 Chr8:13365089..13365195 CATTGGACTGTCCGAAGGTT Chr8:13365178..13365197 59.97 50
downstream ENSMUSE00000272558 Chr8:13369459..13369580 ACAAAATGCGTGTTGGGAGT Chr8:13369541..13369560 60.42 45
downstream ENSMUSE00000514215 Chr8:13370481..13370646 ATTCTTCTCGCCCTTCCTGT Chr8:13370511..13370530 60.21 50
downstream ENSMUSE00000272546 Chr8:13370879..13371022 AAGTTCTGGCACTCCTGAGC Chr8:13371021..13371040 59.6 55
downstream ENSMUSE00000272513 Chr8:13371352..13371420 TGGAGCTGTGACTGCTTCTG Chr8:13371407..13371426 60.33 55
downstream ENSMUSE00000272506 Chr8:13372466..13372617 ATGAAGGGCAAGTGGATGAC Chr8:13372566..13372585 59.93 50
downstream ENSMUSE00000272500 Chr8:13372936..13373102 CATCGTGGATCTCAAACGTG Chr8:13372985..13373004 60.11 50
downstream ENSMUSE00000272493 Chr8:13373845..13373923 CGTGACGAATACTCCACCAA Chr8:13373885..13373904 59.57 50
downstream ENSMUSE00000472934 Chr8:13377142..13378446 CAACTGTTGAGGGGCAAAAT Chr8:13377613..13377632 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCCTGCCTTCCTTTACCT Chr8:13354719..13354739 60.49 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCCTGCCTTCCTTTACCT Chr8:13354719..13354739 60.49 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038482