Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23433
Trapped Gene
Dmtf1 (ENSMUSG00000042508)
Vector Insertion
Chr 5: 9137241 - 9140385
Public Clones IST13306C5 (tigm) IST13251C2 (tigm) IST13034C3 (tigm) IST10702G11 (tigm)
IST13034B4 (tigm) IST13749A5 (tigm) IST13405D1 (tigm) IST13020G4 (tigm)
IST13405D1 (tigm) IST14023E12 (tigm) IST14255D5 (tigm)
Private Clones OST259937 (lexicon) OST179663 (lexicon) OST116823 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000553719 (Chr5:9140386..9140480 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGACGGCAACTACAGAGG Chr5:9140430..9140449 59.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000553719 (Chr5:9140386..9140480 -)
Downstram Exon
ENSMUSE00000310082 (Chr5:9137126..9137240 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGACGGCAACTACAGAGG Chr5:9140430..9140449 59.31 55 AAACCACGCTTGGCTAACTG Chr5:9137141..9137160 60.31 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655995 Chr5:9161614..9161718 TCCTGGTTCTTCCAAAGTGC Chr5:9161632..9161651 60.23 50
upstream ENSMUSE00000508078 Chr5:9151798..9151918 GGTGGGATTCTATGGGAAGG Chr5:9151825..9151844 60.52 55
upstream ENSMUSE00000463616 Chr5:9150376..9150492 ACGGACGGGAATCTCATTCT Chr5:9150393..9150412 60.85 50
upstream ENSMUSE00000655990 Chr5:9148900..9149022 TGCATATCAGTCGTGGCACT Chr5:9148905..9148924 60.3 50
upstream ENSMUSE00000553719 Chr5:9140386..9140480 CATGACGGCAACTACAGAGG Chr5:9140430..9140449 59.31 55

*** Putative Vector Insertion (Chr 5: 9137241 - 9140385) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310082 Chr5:9137126..9137240 AAACCACGCTTGGCTAACTG Chr5:9137141..9137160 60.31 50
downstream ENSMUSE00000336817 Chr5:9136066..9136142 TCAGATAGCGCTCGATGTTG Chr5:9136046..9136065 60.12 50
downstream ENSMUSE00000310074 Chr5:9132456..9132613 TACATGCGCAGCACTCTTCT Chr5:9132458..9132477 59.77 50
downstream ENSMUSE00000334441 Chr5:9131276..9131308 GAGCTTCTCGATCTCTTCAGGA Chr5:9131259..9131280 60.23 50
downstream ENSMUSE00000389206 Chr5:9130541..9130652 ATTGTGTGGGGTCCACAGTT Chr5:9130609..9130628 60.13 50
downstream ENSMUSE00000309992 Chr5:9130368..9130477 CCAGTCATTGCCGTGTTTTA Chr5:9130428..9130447 59.58 45
downstream ENSMUSE00000309982 Chr5:9129148..9129376 AGCCATTTAGAACGGCATTG Chr5:9129198..9129217 60.1 45
downstream ENSMUSE00000309973 Chr5:9127957..9128108 CACTGTGGTGAACGGACACT Chr5:9128000..9128019 59.62 55
downstream ENSMUSE00000553716 Chr5:9126540..9126643 AGACGTGGGTGATCTGGACT Chr5:9126518..9126537 59.56 55
downstream ENSMUSE00000553733 Chr5:9126540..9126749 AGACGTGGGTGATCTGGACT Chr5:9126518..9126537 59.56 55
downstream ENSMUSE00000309959 Chr5:9124442..9124527 AGCAGGGGAGTCTGTTGAAG Chr5:9124486..9124505 59.45 55
downstream ENSMUSE00000553714 Chr5:9124442..9124527 AGCAGGGGAGTCTGTTGAAG Chr5:9124486..9124505 59.45 55
downstream ENSMUSE00000702578 Chr5:9122384..9122461 TTAAGGCATGTCCCCTTGTC Chr5:9122385..9122404 59.93 50
downstream ENSMUSE00000485999 Chr5:9121782..9121937 CTGGAGTACCAGTGGGCTGT Chr5:9121885..9121904 60.17 60
downstream ENSMUSE00000655981 Chr5:9121782..9121937 CTGGAGTACCAGTGGGCTGT Chr5:9121885..9121904 60.17 60
downstream ENSMUSE00000464162 Chr5:9121085..9121462 GGTCAGTGTCGGCAATTTCT Chr5:9121113..9121132 60.12 50
downstream ENSMUSE00000629056 Chr5:9121085..9121462 GGTCAGTGTCGGCAATTTCT Chr5:9121113..9121132 60.12 50
downstream ENSMUSE00000462846 Chr5:9120350..9120494 GGTGCACTATGGTGGGAGAC Chr5:9120445..9120464 60.4 60
downstream ENSMUSE00000655977 Chr5:9120350..9120494 GGTGCACTATGGTGGGAGAC Chr5:9120445..9120464 60.4 60
downstream ENSMUSE00000467208 Chr5:9118841..9120138 AGCAATGGGTTAACCAGCAC Chr5:9119510..9119529 60 50
downstream ENSMUSE00000655983 Chr5:9118841..9120138 AGCAATGGGTTAACCAGCAC Chr5:9119510..9119529 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGCAGTGTGCACTCAAAA Chr5:9137368..9137388 60.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCAGTGTGCACTCAAAAGT Chr5:9137366..9137387 59.97 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr5:9137411..9137431 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGACGTGACTGGGAAAACC Chr5:9137414..9137434 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042508