Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23464
Trapped Gene
Uqcc (ENSMUSG00000005882)
Vector Insertion
Chr 2: 155712954 - 155727033
Public Clones not available
Private Clones OST258429 (lexicon) OST101351 (lexicon)
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171155 (Chr2:155727034..155727091 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171155 (Chr2:155727034..155727091 -)
Downstram Exon
ENSMUSE00000171154 (Chr2:155712845..155712953 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681017 Chr2:155755749..155755780 No primer for this exon
upstream ENSMUSE00000681019 Chr2:155755749..155755779 No primer for this exon
upstream ENSMUSE00000681041 Chr2:155755749..155756046 No primer for this exon
upstream ENSMUSE00000708479 Chr2:155755749..155755786 No primer for this exon
upstream ENSMUSE00000716957 Chr2:155755749..155755786 No primer for this exon
upstream ENSMUSE00000594459 Chr2:155747371..155747463 No primer for this exon
upstream ENSMUSE00000594462 Chr2:155747371..155747463 No primer for this exon
upstream ENSMUSE00000681021 Chr2:155737482..155737572 No primer for this exon
upstream ENSMUSE00000594458 Chr2:155737477..155737572 No primer for this exon
upstream ENSMUSE00000594461 Chr2:155737477..155737572 No primer for this exon
upstream ENSMUSE00000594457 Chr2:155736093..155736200 No primer for this exon
upstream ENSMUSE00000594460 Chr2:155736093..155736200 No primer for this exon
upstream ENSMUSE00000171151 Chr2:155735089..155735161 No primer for this exon
upstream ENSMUSE00000171155 Chr2:155727034..155727091 No primer for this exon

*** Putative Vector Insertion (Chr 2: 155712954 - 155727033) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171154 Chr2:155712845..155712953 No primer for this exon
downstream ENSMUSE00000171156 Chr2:155683848..155683925 No primer for this exon
downstream ENSMUSE00000681020 Chr2:155683848..155683867 No primer for this exon
downstream ENSMUSE00000323259 Chr2:155677095..155677208 No primer for this exon
downstream ENSMUSE00000639639 Chr2:155673995..155674262 No primer for this exon
downstream ENSMUSE00000681016 Chr2:155673976..155674262 No primer for this exon
downstream ENSMUSE00000681023 Chr2:155672633..155674262 No primer for this exon
downstream ENSMUSE00000505531 Chr2:155672632..155674262 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCCTGCTTCATGTCTGGT Chr2:155727030..155727050 59.58 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCCTGCTTCATGTCTGGT Chr2:155727030..155727050 59.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005882