Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23471
Trapped Gene
Znfx1 (ENSMUSG00000039501)
Vector Insertion
Chr 2: 166885643 - 166888009
Public Clones (sanger)
Private Clones OST258197 (lexicon) OST195417 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679510 (Chr2:166888010..166888515 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTATCACGCACCTGCTTCT Chr2:166888059..166888078 60.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679510 (Chr2:166888010..166888515 -)
Downstram Exon
ENSMUSE00000514356 (Chr2:166885532..166885642 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTATCACGCACCTGCTTCT Chr2:166888059..166888078 60.42 55 ACCTTCGCCTGACTTCGTTA Chr2:166885594..166885613 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679510 Chr2:166888010..166888515 CCTATCACGCACCTGCTTCT Chr2:166888059..166888078 60.42 55

*** Putative Vector Insertion (Chr 2: 166885643 - 166888009) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000514356 Chr2:166885532..166885642 ACCTTCGCCTGACTTCGTTA Chr2:166885594..166885613 59.88 50
downstream ENSMUSE00000234975 Chr2:166880654..166882441 CATACAGCAGTCGCTTGGAA Chr2:166881151..166881170 60.01 50
downstream ENSMUSE00000234968 Chr2:166875814..166875945 CACCAAGATGGGGAATGTCT Chr2:166875832..166875851 59.78 50
downstream ENSMUSE00000511240 Chr2:166873933..166874081 GCACAATGCTGGTCTTCTGA Chr2:166874027..166874046 59.99 50
downstream ENSMUSE00000234950 Chr2:166873041..166873190 GCCCCTTCCTGAAGTTTTTG Chr2:166873122..166873141 60.96 50
downstream ENSMUSE00000234944 Chr2:166872392..166872506 CCCAGCCATTCAAGAATCAT Chr2:166872426..166872445 59.89 45
downstream ENSMUSE00000400189 Chr2:166869496..166869743 TCAATCACTCTGTCCGCTTG Chr2:166869622..166869641 59.98 50
downstream ENSMUSE00000639041 Chr2:166868862..166868912 CTGAGCCAGTAAGGCACAGA Chr2:166868840..166868859 59.19 55
downstream ENSMUSE00000639040 Chr2:166868048..166868187 CGAAGCTCCACCTTCACTCT Chr2:166868113..166868132 59.6 55
downstream ENSMUSE00000639039 Chr2:166867550..166867704 AACTTCGGCATCTTTGAGGA Chr2:166867547..166867566 59.81 45
downstream ENSMUSE00000461429 Chr2:166867194..166867339 CTTAGTGTGGCGATGGTGTG Chr2:166867215..166867234 60.17 55
downstream ENSMUSE00000639038 Chr2:166865659..166865769 TCACTTTTACCAGCCGTTCA Chr2:166865666..166865685 59.32 45
downstream ENSMUSE00000639037 Chr2:166865277..166865372 TCCAGATCCTGGTAAATGTGG Chr2:166865292..166865312 59.8 47.62
downstream ENSMUSE00000519670 Chr2:166861299..166864663 GGACCTGCTCAAGTCGAGTC Chr2:166862745..166862764 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000039501