Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23479
Trapped Gene
Nit1 (ENSMUSG00000013997)
Vector Insertion
Chr 1: 173275044 - 173275132
Public Clones not available
Private Clones OST257937 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716316 (Chr1:173275045..173275131 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716316 (Chr1:173275045..173275131 -)
Downstram Exon
ENSMUSE00000687378 (Chr1:173275045..173275131 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687373 Chr1:173275699..173275776 No primer for this exon
upstream ENSMUSE00000687379 Chr1:173275699..173275759 No primer for this exon
upstream ENSMUSE00000397833 Chr1:173275667..173275737 No primer for this exon
upstream ENSMUSE00000687361 Chr1:173275667..173275777 No primer for this exon
upstream ENSMUSE00000687378 Chr1:173275045..173275131 No primer for this exon
upstream ENSMUSE00000716316 Chr1:173275045..173275131 No primer for this exon
upstream ENSMUSE00000718430 Chr1:173275045..173275131 No primer for this exon

*** Putative Vector Insertion (Chr 1: 173275044 - 173275132) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000299462 Chr1:173274419..173274670 No primer for this exon
downstream ENSMUSE00000687357 Chr1:173274419..173274670 No primer for this exon
downstream ENSMUSE00000299456 Chr1:173274195..173274298 No primer for this exon
downstream ENSMUSE00000161465 Chr1:173273825..173273958 No primer for this exon
downstream ENSMUSE00000161466 Chr1:173273569..173273694 No primer for this exon
downstream ENSMUSE00000687370 Chr1:173272375..173272928 No primer for this exon
downstream ENSMUSE00000486047 Chr1:173270709..173272928 No primer for this exon
downstream ENSMUSE00000687355 Chr1:173270702..173272928 No primer for this exon
downstream ENSMUSE00000687374 Chr1:173268139..173268768 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACTAATCGCCTTGCAGCAC Chr1:173275064..173275084 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTACCGGATACCGTGACTGG Chr1:173275072..173275092 60.26 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013997