Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23488
Trapped Gene
B230317C12Rik (ENSMUSG00000036186)
Vector Insertion
Chr 2: 26484220 - 26488123
Public Clones not available
Private Clones OST257783 (lexicon) OST237777 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000519152 (Chr2:26484157..26484219 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGCACCTAGTGCTCCTCT Chr2:26484177..26484196 59.48 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000519152 (Chr2:26484157..26484219 +)
Downstram Exon
ENSMUSE00000520037 (Chr2:26488124..26488258 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGCACCTAGTGCTCCTCT Chr2:26484177..26484196 59.48 60 AGTGCACGTAGACCATCCAG Chr2:26488211..26488230 58.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000519152 Chr2:26484157..26484219 GGTGCACCTAGTGCTCCTCT Chr2:26484177..26484196 59.48 60

*** Putative Vector Insertion (Chr 2: 26484220 - 26488123) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000520037 Chr2:26488124..26488258 AGTGCACGTAGACCATCCAG Chr2:26488211..26488230 58.75 55
downstream ENSMUSE00000233920 Chr2:26490308..26490415 AGGTCCTCCACTCCACCTTT Chr2:26490392..26490411 59.97 55
downstream ENSMUSE00000233915 Chr2:26490507..26490683 ATCTCCCGGAACTCCTTGAT Chr2:26490667..26490686 59.9 50
downstream ENSMUSE00000491956 Chr2:26491059..26492012 AAGATAGAGGTCCCCGCAGT Chr2:26491268..26491287 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGTGCTCCTCTGCCCCTTC Chr2:26484186..26484206 61.82 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGCTCCTCTGCCCCTTCT Chr2:26484187..26484207 62.76 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036186