Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2350
Trapped Gene
2010111I01Rik (ENSMUSG00000021458)
Vector Insertion
Chr 13: 63383567 - 63398165
Public Clones (sanger) AJ0578 (sanger) (sanger) (sanger) AD0611 (sanger) Q015F01 (ggtc)
(ggtc) E028H04 (ggtc) M119B05 (ggtc) (ggtc) D145A06 (ggtc) IST14885H11 (tigm)
IST11557F11 (tigm) IST14384C7 (tigm)
Private Clones OST429645 (lexicon) OST386378 (lexicon) OST357111 (lexicon) OST288756 (lexicon)
OST279737 (lexicon) OST248325 (lexicon) OST203049 (lexicon) OST170841 (lexicon)
OST147205 (lexicon) OST70918 (lexicon) OST61866 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000338658 (Chr13:63383450..63383566 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000338658 (Chr13:63383450..63383566 +)
Downstram Exon
ENSMUSE00000383929 (Chr13:63398166..63398252 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681617 Chr13:63116294..63117323 No primer for this exon
upstream ENSMUSE00000323812 Chr13:63116527..63117323 No primer for this exon
upstream ENSMUSE00000323804 Chr13:63134383..63134549 No primer for this exon
upstream ENSMUSE00000323793 Chr13:63162395..63162554 No primer for this exon
upstream ENSMUSE00000614335 Chr13:63169400..63169645 No primer for this exon
upstream ENSMUSE00000614334 Chr13:63257906..63258095 No primer for this exon
upstream ENSMUSE00000614333 Chr13:63272301..63272407 No primer for this exon
upstream ENSMUSE00000614332 Chr13:63291788..63291890 No primer for this exon
upstream ENSMUSE00000614331 Chr13:63292375..63292482 No primer for this exon
upstream ENSMUSE00000614330 Chr13:63300816..63300859 No primer for this exon
upstream ENSMUSE00000614329 Chr13:63311415..63311475 No primer for this exon
upstream ENSMUSE00000614328 Chr13:63341396..63341464 No primer for this exon
upstream ENSMUSE00000410517 Chr13:63341566..63341640 No primer for this exon
upstream ENSMUSE00000338658 Chr13:63383450..63383566 No primer for this exon

*** Putative Vector Insertion (Chr 13: 63383567 - 63398165) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383929 Chr13:63398166..63398252 No primer for this exon
downstream ENSMUSE00000641517 Chr13:63400020..63400164 No primer for this exon
downstream ENSMUSE00000681602 Chr13:63400020..63400964 No primer for this exon
downstream ENSMUSE00000570645 Chr13:63403087..63403592 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCCTGTAACTGAGCAAGC Chr13:63389579..63389599 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCCTGTAACTGAGCAAGC Chr13:63389579..63389599 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021458