Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23503
Trapped Gene
Irak3 (ENSMUSG00000020227)
Vector Insertion
Chr 10: 119619765 - 119638382
Public Clones (sanger) IST12777B3 (tigm) IST10031D10 (tigm)
Private Clones OST256009 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000241567 (Chr10:119638383..119638593 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000241567 (Chr10:119638383..119638593 -)
Downstram Exon
ENSMUSE00000241560 (Chr10:119619582..119619764 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000241567 Chr10:119638383..119638593 No primer for this exon

*** Putative Vector Insertion (Chr 10: 119619765 - 119638382) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000241560 Chr10:119619582..119619764 No primer for this exon
downstream ENSMUSE00000102008 Chr10:119615752..119615855 No primer for this exon
downstream ENSMUSE00000102004 Chr10:119615124..119615178 No primer for this exon
downstream ENSMUSE00000102005 Chr10:119613287..119613438 No primer for this exon
downstream ENSMUSE00000102003 Chr10:119607374..119607438 No primer for this exon
downstream ENSMUSE00000102001 Chr10:119603461..119603575 No primer for this exon
downstream ENSMUSE00000398454 Chr10:119602149..119602267 No primer for this exon
downstream ENSMUSE00000361517 Chr10:119583487..119583685 No primer for this exon
downstream ENSMUSE00000241629 Chr10:119582954..119583016 No primer for this exon
downstream ENSMUSE00000241622 Chr10:119582702..119582866 No primer for this exon
downstream ENSMUSE00000241613 Chr10:119578710..119580247 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGCAAGGCAACTATTCC Chr10:119629378..119629398 61.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGCAAGGCAACTATTCC Chr10:119629378..119629398 61.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGTCGTGGAGCTGAATTTCC Chr10:119632581..119632601 63.02 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAATTTCCGCGGTTGTGAAAG Chr10:119635568..119635589 63.9 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020227