Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23518
Trapped Gene
Ctrb1 (ENSMUSG00000031957)
Vector Insertion
Chr 8: 114213305 - 114213396
Public Clones not available
Private Clones OST255184 (lexicon) OST133306 (lexicon) OST90216 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307050 (Chr8:114213397..114213500 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTCAACGGAGAGGATGCTA Chr8:114213432..114213451 61.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307050 (Chr8:114213397..114213500 -)
Downstram Exon
ENSMUSE00000214949 (Chr8:114213225..114213304 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTCAACGGAGAGGATGCTA Chr8:114213432..114213451 61.34 55 AGCAGTGACCACCCAGTTTT Chr8:114213220..114213239 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214948 Chr8:114214841..114214910 CATTCCTTTGGCTTGTGTCC Chr8:114214869..114214888 60.49 50
upstream ENSMUSE00000307050 Chr8:114213397..114213500 CGTCAACGGAGAGGATGCTA Chr8:114213432..114213451 61.34 55

*** Putative Vector Insertion (Chr 8: 114213305 - 114213396) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214949 Chr8:114213225..114213304 AGCAGTGACCACCCAGTTTT Chr8:114213220..114213239 59.62 50
downstream ENSMUSE00000214951 Chr8:114213041..114213119 AGCCCTGATCAAACTCTCCA Chr8:114213057..114213076 59.8 50
downstream ENSMUSE00000214947 Chr8:114212445..114212625 ATGTCATTACGCACGGTGAA Chr8:114212557..114212576 59.99 45
downstream ENSMUSE00000307035 Chr8:114211001..114211134 TCACATCGGTGATCTTGGAA Chr8:114211017..114211036 60.05 45
downstream ENSMUSE00000307027 Chr8:114210419..114210648 GTCCAGACTCCGTCCTTCTG Chr8:114210580..114210599 59.83 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGAGGAGGATCTGGGAAC Chr8:114213374..114213394 59.18 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031957