Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2352
Trapped Gene
Cbx6 (ENSMUSG00000022421)
Vector Insertion
Chr 15: 79658266 - 79658713
Public Clones AD0590 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000557470 (Chr15:79658470..79658712 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCGTGACCATCAAGGAAT Chr15:79658496..79658515 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000557470 (Chr15:79658470..79658712 -)
Downstram Exon
ENSMUSE00000681000 (Chr15:79658267..79658861 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCGTGACCATCAAGGAAT Chr15:79658496..79658515 59.79 50 AGCTGTATGTAGCGCCTGGT Chr15:79658601..79658620 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377149 Chr15:79664573..79664667 GCCGAATCCATCATTAAACG Chr15:79664586..79664605 60.29 45
upstream ENSMUSE00000681003 Chr15:79664573..79664656 GCCGAATCCATCATTAAACG Chr15:79664586..79664605 60.29 45
upstream ENSMUSE00000681008 Chr15:79664573..79665118 ATGCACAGCGCCTAGAGACT Chr15:79665092..79665111 60.19 55
upstream ENSMUSE00000714556 Chr15:79664573..79664667 GCCGAATCCATCATTAAACG Chr15:79664586..79664605 60.29 45
upstream ENSMUSE00000126396 Chr15:79664345..79664388 CGAGTACCTGGTGAAATGGAA Chr15:79664360..79664380 59.98 47.62
upstream ENSMUSE00000126394 Chr15:79664132..79664197 TTCTGGATTCGAGGCTCATC Chr15:79664149..79664168 60.3 50
upstream ENSMUSE00000126397 Chr15:79663942..79664008 AGGGAACGTGAGCTGTATGG Chr15:79663985..79664004 60.13 55
upstream ENSMUSE00000681001 Chr15:79659269..79659408 CACCGGCTCAAGAAAGACAT Chr15:79659287..79659306 60.26 50
upstream ENSMUSE00000557450 Chr15:79659118..79659408 CACCGGCTCAAGAAAGACAT Chr15:79659287..79659306 60.26 50
upstream ENSMUSE00000557473 Chr15:79658749..79659408 GATGCACCACCCAAGCTACT Chr15:79658765..79658784 60.14 55
upstream ENSMUSE00000557470 Chr15:79658470..79658712 GACCGTGACCATCAAGGAAT Chr15:79658496..79658515 59.79 50
upstream ENSMUSE00000681000 Chr15:79658267..79658861 GCTTAGCTTGCCTCAGATGG Chr15:79658295..79658314 60.12 55

*** Putative Vector Insertion (Chr 15: 79658266 - 79658713) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681006 Chr15:79656571..79659354 AACCGTAAAGGGTGTTGCAG Chr15:79657598..79657617 60.03 50
downstream ENSMUSE00000681007 Chr15:79654326..79659408 ACCTTAGGGCTGGTTGTCCT Chr15:79656213..79656232 59.99 55
downstream ENSMUSE00000362048 Chr15:79634405..79635147 CGTACAGAGGAAGCGACTGA Chr15:79634704..79634723 59.19 55
downstream ENSMUSE00000126378 Chr15:79624686..79624905 TGGCCTTCTAGTTCGTCCAT Chr15:79624792..79624811 59.69 50
downstream ENSMUSE00000126379 Chr15:79623033..79623280 CATGTAGTTGTTGCGGATGG Chr15:79623194..79623213 59.99 50
downstream ENSMUSE00000126383 Chr15:79620696..79620875 TATGGTGCCAGTTGCTGTCT Chr15:79620808..79620827 59.32 50
downstream ENSMUSE00000706329 Chr15:79620122..79620346 GTGCAATGTCACCAACGAAG Chr15:79620270..79620289 60.16 50
downstream ENSMUSE00000126381 Chr15:79616782..79620346 ACATAGGTCGTGCCCAGAAC Chr15:79617437..79617456 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCTGTCCATCCCTCCTGA Chr15:79658691..79658711 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATCTGTCCATCCCTCCTGA Chr15:79658691..79658711 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022421