Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23531
Trapped Gene
Spag7 (ENSMUSG00000018287)
Vector Insertion
Chr 11: 70478370 - 70478489
Public Clones not available
Private Clones OST254234 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000109648 (Chr11:70478490..70478578 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000109648 (Chr11:70478490..70478578 -)
Downstram Exon
ENSMUSE00000109644 (Chr11:70478285..70478369 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000383802 Chr11:70482699..70482795 No primer for this exon
upstream ENSMUSE00000109641 Chr11:70478799..70478866 No primer for this exon
upstream ENSMUSE00000109648 Chr11:70478490..70478578 No primer for this exon

*** Putative Vector Insertion (Chr 11: 70478370 - 70478489) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109644 Chr11:70478285..70478369 No primer for this exon
downstream ENSMUSE00000109637 Chr11:70478080..70478169 No primer for this exon
downstream ENSMUSE00000109645 Chr11:70477822..70477978 No primer for this exon
downstream ENSMUSE00000374986 Chr11:70477292..70477722 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAAGAAATGGGCAATAGA Chr11:70478446..70478466 60.04 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAAGAAATGGGCAATAGA Chr11:70478446..70478466 60.04 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018287