Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23537
Trapped Gene
March9 (ENSMUSG00000040502)
Vector Insertion
Chr 10: 126495432 - 126496453
Public Clones not available
Private Clones OST253953 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000607350 (Chr10:126496454..126497240 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGTTCCTGAACGAGCTGA Chr10:126496771..126496790 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000607350 (Chr10:126496454..126497240 -)
Downstram Exon
ENSMUSE00000373460 (Chr10:126495276..126495431 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGTTCCTGAACGAGCTGA Chr10:126496771..126496790 59.98 50 CATGAGCCCCTCTCACTGAT Chr10:126495318..126495337 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000607350 Chr10:126496454..126497240 CATGTTCCTGAACGAGCTGA Chr10:126496771..126496790 59.98 50

*** Putative Vector Insertion (Chr 10: 126495432 - 126496453) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000373460 Chr10:126495276..126495431 CATGAGCCCCTCTCACTGAT Chr10:126495318..126495337 60.22 55
downstream ENSMUSE00000573503 Chr10:126494488..126494680 GCAGCAATCTGGACCTTCTC Chr10:126494612..126494631 59.96 55
downstream ENSMUSE00000451762 Chr10:126493106..126493967 TGGCATTGGTCTCCCTTTAC Chr10:126493252..126493271 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGTGCAGGATCTGCTTCC Chr10:126496466..126496486 63.26 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGTGCAGGATCTGCTTCC Chr10:126496466..126496486 63.26 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040502