Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2355
Trapped Gene
Spata5l1 (ENSMUSG00000074876)
Vector Insertion
Chr 2: 122458441 - 122459459
Public Clones AD0574 (sanger) AD0326 (sanger) RRN178 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641598 (Chr2:122458255..122458440 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATTGGAACTCCCACCCTTA Chr2:122458260..122458279 59.78 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641598 (Chr2:122458255..122458440 +)
Downstram Exon
ENSMUSE00000684218 (Chr2:122459460..122459483 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATTGGAACTCCCACCCTTA Chr2:122458260..122458279 59.78 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641599 Chr2:122456422..122457495 TCTTCCTGGACGAAGTGGAT Chr2:122457299..122457318 59.65 50
upstream ENSMUSE00000641598 Chr2:122458255..122458440 CATTGGAACTCCCACCCTTA Chr2:122458260..122458279 59.78 50

*** Putative Vector Insertion (Chr 2: 122458441 - 122459459) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000684218 Chr2:122459460..122459483 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr2:122458491..122458511 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGTAATCTTTCCGTGACTGG Chr2:122458479..122458501 60.24 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074876