Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23566
Trapped Gene
Atf3 (ENSMUSG00000026628)
Vector Insertion
Chr 1: 193001354 - 193006971
Public Clones not available
Private Clones OST252919 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386299 (Chr1:193006972..193007131 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386299 (Chr1:193006972..193007131 -)
Downstram Exon
ENSMUSE00000161254 (Chr1:193001110..193001353 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GATGGCGAATCTCAGCTCTT Chr1:193001181..193001200 59.54 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386299 Chr1:193006972..193007131 No primer for this exon

*** Putative Vector Insertion (Chr 1: 193001354 - 193006971) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000161254 Chr1:193001110..193001353 GATGGCGAATCTCAGCTCTT Chr1:193001181..193001200 59.54 50
downstream ENSMUSE00000161256 Chr1:192996254..192996361 ACACTTGGCAGCAGCAATTT Chr1:192996271..192996290 60.84 45
downstream ENSMUSE00000426265 Chr1:192994191..192995558 GGTGTCGTCCATCCTCTGTT Chr1:192994620..192994639 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGTGTCCCCAAGTAAGC Chr1:193006963..193006983 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTGTGTCCCCAAGTAAGC Chr1:193006963..193006983 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026628