Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23572
Trapped Gene
Cep68 (ENSMUSG00000044066)
Vector Insertion
Chr 11: 20142242 - 20149309
Public Clones (sanger) (sanger) E087G01 (ggtc) IST14802C3 (tigm) IST10937F1 (tigm)
IST10871G3 (tigm) IST14710H10 (tigm) IST10871G3 (tigm)
Private Clones OST252800 (lexicon) OST239500 (lexicon) OST211693 (lexicon) OST191629 (lexicon)
OST115799 (lexicon) OST97763 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680880 (Chr11:20149310..20149374 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680880 (Chr11:20149310..20149374 -)
Downstram Exon
ENSMUSE00000712621 (Chr11:20141889..20142241 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGTAGGGGCTGATCTGGTTC Chr11:20142057..20142076 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337123 Chr11:20149310..20149421 No primer for this exon
upstream ENSMUSE00000680880 Chr11:20149310..20149374 No primer for this exon

*** Putative Vector Insertion (Chr 11: 20142242 - 20149309) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000389471 Chr11:20141889..20142241 TGTAGGGGCTGATCTGGTTC Chr11:20142057..20142076 60.07 55
downstream ENSMUSE00000712621 Chr11:20141889..20142241 TGTAGGGGCTGATCTGGTTC Chr11:20142057..20142076 60.07 55
downstream ENSMUSE00000333483 Chr11:20139199..20140701 CAGTCAACTCGGGAGAGGAG Chr11:20140349..20140368 59.98 60
downstream ENSMUSE00000370638 Chr11:20138469..20138591 GACCTGTAAGGCTGGTCCTG Chr11:20138473..20138492 59.72 60
downstream ENSMUSE00000680871 Chr11:20138389..20138591 CATCCCCGTGGATAAACAAG Chr11:20138410..20138429 60.18 50
downstream ENSMUSE00000440688 Chr11:20136009..20136105 CTGGGGTGTTATCCAACAGG Chr11:20135987..20136006 60.22 55
downstream ENSMUSE00000706151 Chr11:20130431..20130597 AAGATGATCTGCACGGCTCT Chr11:20130508..20130527 59.98 50
downstream ENSMUSE00000440702 Chr11:20130427..20130597 AAGATGATCTGCACGGCTCT Chr11:20130508..20130527 59.98 50
downstream ENSMUSE00000655325 Chr11:20128509..20129484 AAAGACTCCCCGCTTTTCAT Chr11:20128787..20128806 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTAGCTCCTCCCTCACCAG Chr11:20149293..20149313 60.4 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTAGCTCCTCCCTCACCAG Chr11:20149293..20149313 60.4 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCTTTCCCTCTGTTGTGTG Chr11:20143325..20143345 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCTTTCCCTCTGTTGTGTG Chr11:20143325..20143345 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044066