Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23595
Trapped Gene
Rela (ENSMUSG00000024927)
Vector Insertion
Chr 19: 5637842 - 5638431
Public Clones IST10077E1 (tigm)
Private Clones OST252296 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716014 (Chr19:5637759..5637841 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGGCGAATGGCTTTACTT Chr19:5637762..5637781 59.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716014 (Chr19:5637759..5637841 +)
Downstram Exon
ENSMUSE00000622476 (Chr19:5638432..5638458 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGGCGAATGGCTTTACTT Chr19:5637762..5637781 59.85 45 GAGGGAAAGATGAGGGGAAA Chr19:5638459..5638478 60.38 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713993 Chr19:5637759..5637841 TCTGGCGAATGGCTTTACTT Chr19:5637762..5637781 59.85 45
upstream ENSMUSE00000716014 Chr19:5637759..5637841 TCTGGCGAATGGCTTTACTT Chr19:5637762..5637781 59.85 45

*** Putative Vector Insertion (Chr 19: 5637842 - 5638431) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000261250 Chr19:5638432..5638458 GAGGGAAAGATGAGGGGAAA Chr19:5638459..5638478 60.38 50
downstream ENSMUSE00000622476 Chr19:5638432..5638458 GAGGGAAAGATGAGGGGAAA Chr19:5638459..5638478 60.38 50
downstream ENSMUSE00000644219 Chr19:5638551..5638702 CTTCGGCTGTTCGATGATCT Chr19:5638603..5638622 60.36 50
downstream ENSMUSE00000696513 Chr19:5638551..5638702 CTTCGGCTGTTCGATGATCT Chr19:5638603..5638622 60.36 50
downstream ENSMUSE00000644218 Chr19:5638855..5639003 CCTGGTCCTGTGTAGCCATT Chr19:5638880..5638899 59.99 55
downstream ENSMUSE00000696512 Chr19:5638855..5639003 CCTGGTCCTGTGTAGCCATT Chr19:5638880..5638899 59.99 55
downstream ENSMUSE00000146285 Chr19:5639859..5639950 CTAATGGCTTGCTCCAGGTC Chr19:5639918..5639937 59.84 55
downstream ENSMUSE00000146289 Chr19:5640303..5640434 ATCGGATGTGAGAGGACAGG Chr19:5640426..5640445 60.07 55
downstream ENSMUSE00000146291 Chr19:5641181..5641285 ATCTTGAGCTCGGCAGTGTT Chr19:5641211..5641230 60.02 50
downstream ENSMUSE00000146282 Chr19:5641464..5641676 CTGGTCCCGTGAAATACACC Chr19:5641496..5641515 60.23 55
downstream ENSMUSE00000146287 Chr19:5645325..5645405 CATAGGTCCTTTTGCGCTTC Chr19:5645369..5645388 59.85 50
downstream ENSMUSE00000146286 Chr19:5645513..5645587 GCTTGGGGACAGAAGTTGAG Chr19:5645587..5645606 59.84 55
downstream ENSMUSE00000261080 Chr19:5646800..5648130 GTTAATGCTCCTGCGAAAGC Chr19:5647598..5647617 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr19:5637892..5637912 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000024927