Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23612
Trapped Gene
AC161608.5 (ENSMUSG00000075507)
Vector Insertion
Chr 14: 78922510 - 78936518
Public Clones not available
Private Clones OST251724 (lexicon) OST110703 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000685694 (Chr14:78936519..78936587 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000685694 (Chr14:78936519..78936587 -)
Downstram Exon
ENSMUSE00000613137 (Chr14:78922398..78922509 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGAAAGCCGCCATAACTGTA Chr14:78922423..78922442 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685694 Chr14:78936519..78936587 No primer for this exon

*** Putative Vector Insertion (Chr 14: 78922510 - 78936518) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000613137 Chr14:78922398..78922509 GGAAAGCCGCCATAACTGTA Chr14:78922423..78922442 60.1 50
downstream ENSMUSE00000613136 Chr14:78918587..78918703 CAGACCGGAACACATCTTCA Chr14:78918654..78918673 59.68 50
downstream ENSMUSE00000613135 Chr14:78917980..78918027 TCATTAAAGCCCAGAAACGTG Chr14:78917983..78918003 60.12 42.86
downstream ENSMUSE00000613134 Chr14:78916130..78916264 ACTGCAAAAATGGAGCGAAT Chr14:78916183..78916202 59.71 40
downstream ENSMUSE00000613133 Chr14:78914614..78914878 AAGCATTCCCGAATGATGAC Chr14:78914836..78914855 59.9 45
downstream ENSMUSE00000613126 Chr14:78913160..78914127 CCTTGCGTCCCAGTACATTT Chr14:78913947..78913966 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr14:78924447..78924467 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACCTGCGTTTTAGATTGC Chr14:78924492..78924512 58.92 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075507