Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23638
Trapped Gene
Sox15 (ENSMUSG00000041287)
Vector Insertion
Chr 11: 69469402 - 69469954
Public Clones CMHD-GT_450H6-3 (cmhd)
Private Clones OST250886 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411935 (Chr11:69468539..69469401 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAACCCTGTCTCGCTGAA Chr11:69468621..69468640 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411935 (Chr11:69468539..69469401 +)
Downstram Exon
ENSMUSE00000329696 (Chr11:69469955..69470210 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAACCCTGTCTCGCTGAA Chr11:69468621..69468640 59.99 50 TGGGATCACTCTGAGGGAAG Chr11:69470016..69470035 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411935 Chr11:69468539..69469401 AAGAACCCTGTCTCGCTGAA Chr11:69468621..69468640 59.99 50

*** Putative Vector Insertion (Chr 11: 69469402 - 69469954) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000329696 Chr11:69469955..69470210 TGGGATCACTCTGAGGGAAG Chr11:69470016..69470035 60.19 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTTCCCACACGACCTAAT Chr11:69469437..69469457 60.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATCTGTCTGTTCCATGCTT Chr11:69469421..69469442 60.13 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041287