Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23643
Trapped Gene
Ufc1 (ENSMUSG00000062963)
Vector Insertion
Chr 1: 173219103 - 173219301
Public Clones CMHD-GT_431H8-3 (cmhd)
Private Clones OST250828 (lexicon) OST224885 (lexicon) OST18530 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506703 (Chr1:173219302..173219392 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGGAATGTGCCTAAGTT Chr1:173219330..173219349 59.2 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506703 (Chr1:173219302..173219392 -)
Downstram Exon
ENSMUSE00000687391 (Chr1:173218696..173219102 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGGAATGTGCCTAAGTT Chr1:173219330..173219349 59.2 50 GTCCTTCATTGGCTGCATTT Chr1:173218995..173219014 60.08 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000474117 Chr1:173225052..173225155 GGCTCCGGTGATTTAATGAT Chr1:173225103..173225122 58.86 45
upstream ENSMUSE00000472330 Chr1:173224765..173224958 GACGCCGTGAGTAAGTGACA Chr1:173224929..173224948 59.9 55
upstream ENSMUSE00000687392 Chr1:173224765..173224911 GTGCAGCGACTAAAGGAGGA Chr1:173224784..173224803 60.54 55
upstream ENSMUSE00000471460 Chr1:173220280..173220347 ATGATTGGTTCCGACTGGAG Chr1:173220300..173220319 59.93 50
upstream ENSMUSE00000482934 Chr1:173220015..173220078 TGCTGGTACATCCACGATTT Chr1:173220046..173220065 59 45
upstream ENSMUSE00000510324 Chr1:173219649..173219725 AAATTGCAGTCCCTGAGCTG Chr1:173219675..173219694 60.4 50
upstream ENSMUSE00000506703 Chr1:173219302..173219392 GCCAGGAATGTGCCTAAGTT Chr1:173219330..173219349 59.2 50

*** Putative Vector Insertion (Chr 1: 173219103 - 173219301) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687391 Chr1:173218696..173219102 GTCCTTCATTGGCTGCATTT Chr1:173218995..173219014 60.08 45
downstream ENSMUSE00000518418 Chr1:173218694..173219102 GTCCTTCATTGGCTGCATTT Chr1:173218995..173219014 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTAATCGCCTTGCAGCAC Chr1:173219233..173219253 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCAGGAATGTGCCTAAGTT Chr1:173219328..173219348 59.2 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062963