Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23659
Trapped Gene
Morn3 (ENSMUSG00000029477)
Vector Insertion
Chr 5: 123491250 - 123496639
Public Clones IST12659B8 (tigm) IST12470C10 (tigm) IST12285A9 (tigm) IST12985A9 (tigm)
IST12362D3 (tigm) IST12629B3 (tigm) IST14504H1 (tigm) IST12343A9 (tigm)
IST12285A9 (tigm)
Private Clones OST250219 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000497370 (Chr5:123496640..123496829 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGCCCAGAAGAACGGACT Chr5:123496708..123496727 60.25 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000497370 (Chr5:123496640..123496829 -)
Downstram Exon
ENSMUSE00000649828 (Chr5:123491092..123491249 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGCCCAGAAGAACGGACT Chr5:123496708..123496727 60.25 50 TCCATAACCATCTCGCTTCC Chr5:123491148..123491167 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497370 Chr5:123496640..123496829 AAAGCCCAGAAGAACGGACT Chr5:123496708..123496727 60.25 50

*** Putative Vector Insertion (Chr 5: 123491250 - 123496639) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000649828 Chr5:123491092..123491249 TCCATAACCATCTCGCTTCC Chr5:123491148..123491167 60.04 50
downstream ENSMUSE00000189240 Chr5:123489266..123489425 CCGAAAAACTGGATCCCATA Chr5:123489381..123489400 59.76 45
downstream ENSMUSE00000328409 Chr5:123487685..123487869 GTCCACCCAGTAGCCTTCAA Chr5:123487741..123487760 60.11 55
downstream ENSMUSE00000495618 Chr5:123487142..123487369 AGATTTGCCCTCTCTGGTCA Chr5:123487181..123487200 59.8 50
downstream ENSMUSE00000537470 Chr5:123487142..123487369 AGATTTGCCCTCTCTGGTCA Chr5:123487181..123487200 59.8 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGGGCAACTTGAAACAC Chr5:123496639..123496659 59.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGGGCAACTTGAAACAC Chr5:123496639..123496659 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAGTACCAGGATCCCCAGGA Chr5:123496857..123496877 60.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GATACACGGGAGTCACTGAGC Chr5:123496838..123496859 59.74 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029477