Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23660
Trapped Gene
6230427J02Rik (ENSMUSG00000042106)
Vector Insertion
Chr 9: 107887396 - 107888027
Public Clones CMHD-GT_433C6-3 (cmhd)
Private Clones OST250182 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000248315 (Chr9:107888028..107888210 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGTAAGGCAAGGGTGAGGA Chr9:107888180..107888199 59.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000248315 (Chr9:107888028..107888210 -)
Downstram Exon
ENSMUSE00000248295 (Chr9:107886557..107887395 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGTAAGGCAAGGGTGAGGA Chr9:107888180..107888199 59.28 55 GAGAAACGCTGGCTATGAGG Chr9:107887051..107887070 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000248315 Chr9:107888028..107888210 GAGTAAGGCAAGGGTGAGGA Chr9:107888180..107888199 59.28 55

*** Putative Vector Insertion (Chr 9: 107887396 - 107888027) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248295 Chr9:107886557..107887395 GAGAAACGCTGGCTATGAGG Chr9:107887051..107887070 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCTTTGGAGTGGGTGTGG Chr9:107888003..107888023 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCTTTGGAGTGGGTGTGG Chr9:107888003..107888023 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042106