Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23666
Trapped Gene
Cenpn (ENSMUSG00000031756)
Vector Insertion
Chr 8: 119457364 - 119458594
Public Clones not available
Private Clones OST250008 (lexicon) OST69690 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000323771 (Chr8:119457187..119457363 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATCCCCAGACTCCGTATGC Chr8:119457295..119457314 59.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000323771 (Chr8:119457187..119457363 +)
Downstram Exon
ENSMUSE00000212720 (Chr8:119458595..119458696 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATCCCCAGACTCCGTATGC Chr8:119457295..119457314 59.92 55 CCTCAGATCCAAATGCACAA Chr8:119458648..119458667 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000212727 Chr8:119445640..119445683 No primer for this exon
upstream ENSMUSE00000405354 Chr8:119446228..119446341 CCGAAGTTTATAGCCGCATC Chr8:119446315..119446334 59.7 50
upstream ENSMUSE00000335685 Chr8:119449982..119450162 GAATGTTGCCGAGTTTCTCC Chr8:119450000..119450019 59.68 50
upstream ENSMUSE00000212713 Chr8:119452436..119452481 AAGCGTGCAAGTCTTGATGA Chr8:119452439..119452458 59.6 45
upstream ENSMUSE00000323805 Chr8:119454978..119455037 AATTTCATCGGCACCAGAAG Chr8:119454984..119455003 60.07 45
upstream ENSMUSE00000475889 Chr8:119455494..119455570 No primer for this exon
upstream ENSMUSE00000323771 Chr8:119457187..119457363 TATCCCCAGACTCCGTATGC Chr8:119457295..119457314 59.92 55

*** Putative Vector Insertion (Chr 8: 119457364 - 119458594) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212720 Chr8:119458595..119458696 CCTCAGATCCAAATGCACAA Chr8:119458648..119458667 59.65 45
downstream ENSMUSE00000212715 Chr8:119460094..119460151 GCTTCCTGCAGAGACGTTGT Chr8:119460137..119460156 60.6 55
downstream ENSMUSE00000212707 Chr8:119461062..119461174 TGTGCGAACTCTAGCTGTGG Chr8:119461170..119461189 60.2 55
downstream ENSMUSE00000212722 Chr8:119464344..119464470 GAGGCCCCCACCTATGTTAC Chr8:119464385..119464404 60.58 60
downstream ENSMUSE00000212711 Chr8:119464735..119465403 CCTTGCGTAGTAGCCTCCAG Chr8:119465264..119465283 60.03 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACCACATAATCGCCTTGC Chr8:119457407..119457427 59.97 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGGTAGGAACAGGGGGTA Chr8:119457361..119457381 59.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031756