Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23675
Trapped Gene
Nip7 (ENSMUSG00000031917)
Vector Insertion
Chr 8: 109581080 - 109581172
Public Clones not available
Private Clones OST249579 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214640 (Chr8:109580993..109581079 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCACAACGACCGAGTGTA Chr8:109581051..109581070 60.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214640 (Chr8:109580993..109581079 +)
Downstram Exon
ENSMUSE00000214638 (Chr8:109581173..109581311 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCACAACGACCGAGTGTA Chr8:109581051..109581070 60.93 55 AAGCGGAACTTGTGGGTCTT Chr8:109581274..109581293 61.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214634 Chr8:109580790..109580890 AGATGAGGCCCTTGACTGAA Chr8:109580833..109580852 59.8 50
upstream ENSMUSE00000214640 Chr8:109580993..109581079 CTGCACAACGACCGAGTGTA Chr8:109581051..109581070 60.93 55

*** Putative Vector Insertion (Chr 8: 109581080 - 109581172) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214638 Chr8:109581173..109581311 AAGCGGAACTTGTGGGTCTT Chr8:109581274..109581293 61.05 50
downstream ENSMUSE00000214633 Chr8:109581947..109582087 GTCCGCCATGGAATAGACAA Chr8:109582081..109582100 60.86 50
downstream ENSMUSE00000214636 Chr8:109582277..109582937 CCTGTTTTCACGCCATTTCT Chr8:109582534..109582553 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr8:109581130..109581150 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCACAACGACCGAGTGTA Chr8:109581052..109581072 60.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031917