Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23684
Trapped Gene
Setx (ENSMUSG00000043535)
Vector Insertion
Chr 2: 28995909 - 28999409
Public Clones XE069 (baygenomics) IST13085D3 (tigm)
Private Clones OST249244 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000391697 (Chr2:28995789..28995908 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCACACCATGGAGAAGCAA Chr2:28995882..28995901 60.24 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000391697 (Chr2:28995789..28995908 +)
Downstram Exon
ENSMUSE00000349363 (Chr2:28999410..28999581 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCACACCATGGAGAAGCAA Chr2:28995882..28995901 60.24 45 AGATCCAAGGCGATCAAGAA Chr2:28999480..28999499 59.77 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000451500 Chr2:28980512..28981069 CCCTTCCGTCTGCTGTTCTA Chr2:28980682..28980701 60.39 55
upstream ENSMUSE00000451027 Chr2:28981372..28981483 GGGCCAAAGTGTGAATCTGT Chr2:28981387..28981406 59.97 50
upstream ENSMUSE00000392624 Chr2:28982394..28982583 GCGCTATGCATCTAGCACTG Chr2:28982463..28982482 59.76 55
upstream ENSMUSE00000349328 Chr2:28985700..28985910 GCTTCTGCATGAGCGTGTTA Chr2:28985891..28985910 60.17 50
upstream ENSMUSE00000379228 Chr2:28989442..28989551 TTTGCCGAATGGAACAAAAC Chr2:28989463..28989482 60.85 40
upstream ENSMUSE00000345797 Chr2:28994740..28994959 CGATGGGCTATTCTGACTGC Chr2:28994746..28994765 60.76 55
upstream ENSMUSE00000391697 Chr2:28995789..28995908 TTCACACCATGGAGAAGCAA Chr2:28995882..28995901 60.24 45

*** Putative Vector Insertion (Chr 2: 28995909 - 28999409) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000349363 Chr2:28999410..28999581 AGATCCAAGGCGATCAAGAA Chr2:28999480..28999499 59.77 45
downstream ENSMUSE00000333279 Chr2:28999698..28999785 TGTGGCTCCGGTTCTAACTT Chr2:28999724..28999743 59.73 50
downstream ENSMUSE00000568339 Chr2:29000123..29004241 CTGAGAACTCACCCACAGCA Chr2:29000476..29000495 60.02 55
downstream ENSMUSE00000221953 Chr2:29005528..29005627 GAGAGCTCAGCCATTCCTGT Chr2:29005555..29005574 59.56 55
downstream ENSMUSE00000221946 Chr2:29009458..29009616 TGCCATGCCTGTCCATATAA Chr2:29009559..29009578 59.91 45
downstream ENSMUSE00000486491 Chr2:29012508..29012740 ACACTGGCTGGCAAGGTATC Chr2:29012574..29012593 60.14 55
downstream ENSMUSE00000388759 Chr2:29013618..29013785 CAGGTGGTCCATGAATCAGA Chr2:29013735..29013754 59.47 50
downstream ENSMUSE00000221916 Chr2:29014361..29014517 CACACGAGGACTCGATTTTG Chr2:29014431..29014450 59.29 50
downstream ENSMUSE00000221907 Chr2:29016992..29017093 GGTTGACTTGGCTGTCCAAA Chr2:29017087..29017106 61.08 50
downstream ENSMUSE00000221899 Chr2:29017270..29017385 AGAGCTCGCTGACGAGAAAG Chr2:29017363..29017382 60.03 55
downstream ENSMUSE00000221894 Chr2:29018498..29018569 GCAAGTTCTTGCCTTTCTTTTG Chr2:29018554..29018575 60.4 40.91
downstream ENSMUSE00000221888 Chr2:29019922..29020071 CCCTCGAAAAGCAGACTCAA Chr2:29020035..29020054 60.51 50
downstream ENSMUSE00000346853 Chr2:29021788..29021895 AGTTTATTGCAGCGGTGGAT Chr2:29021849..29021868 59.6 45
downstream ENSMUSE00000353429 Chr2:29026683..29026870 GCCATCATCGACTGGTCATA Chr2:29026723..29026742 59.48 50
downstream ENSMUSE00000221865 Chr2:29027836..29027928 AACACGAGGTAGGGCTGAAA Chr2:29027895..29027914 59.73 50
downstream ENSMUSE00000221860 Chr2:29029077..29029241 TGCCAATATTTCGGAAGGAA Chr2:29029174..29029193 60.4 40
downstream ENSMUSE00000221854 Chr2:29032397..29032495 GCCCTGACACAGGTAACGAT Chr2:29032474..29032493 60 55
downstream ENSMUSE00000221850 Chr2:29033035..29033122 CTTGGCTCGTGTAATGGTGA Chr2:29033086..29033105 59.72 50
downstream ENSMUSE00000646273 Chr2:29034920..29037991 CATGTCTGGGCACTAGCAGA Chr2:29036966..29036985 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCTGGGCTAATCGCCTTG Chr2:28998951..28998971 61.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTAGATTCTGGGCCGTGAC Chr2:28998946..28998966 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043535