Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2374
Trapped Gene
Sfrs10 (ENSMUSG00000022858)
Vector Insertion
Chr 16: 22255191 - 22265813
Public Clones (sanger) AC0465 (sanger) AH0161 (sanger) (sanger) AD0342 (sanger)
CSI162 (baygenomics) P151G04 (ggtc) P133G07 (ggtc) P142D08 (ggtc)
P151G04 (ggtc) P133G07 (ggtc) P016A05 (ggtc) P142D08 (ggtc) PST17451-NR (escells)
IST14250H11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644766 (Chr16:22265814..22265994 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTCCTCGCAAAAGTGTG Chr16:22265943..22265962 61.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644766 (Chr16:22265814..22265994 -)
Downstram Exon
ENSMUSE00000560946 (Chr16:22255057..22255190 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTCCTCGCAAAAGTGTG Chr16:22265943..22265962 61.12 55 GATCCGTGAGCACTTCCACT Chr16:22255128..22255147 60.27 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644766 Chr16:22265814..22265994 GAGCTCCTCGCAAAAGTGTG Chr16:22265943..22265962 61.12 55

*** Putative Vector Insertion (Chr 16: 22255191 - 22265813) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000560946 Chr16:22255057..22255190 GATCCGTGAGCACTTCCACT Chr16:22255128..22255147 60.27 55
downstream ENSMUSE00000560944 Chr16:22254481..22254643 ATCGTCTATGCGAGCGAGAT Chr16:22254551..22254570 59.97 50
downstream ENSMUSE00000560941 Chr16:22252680..22252868 AGACAACAGTTGGGGTCAGG Chr16:22252821..22252840 60 55
downstream ENSMUSE00000560939 Chr16:22250938..22251053 CTAATTCGACGCCCATCAAG Chr16:22250985..22251004 60.6 50
downstream ENSMUSE00000560937 Chr16:22249123..22249206 TAACCCCGATCGTACCCTCT Chr16:22249134..22249153 60.7 55
downstream ENSMUSE00000560933 Chr16:22248509..22248568 CCCTGTCTTGAGCTGCTCTC Chr16:22248500..22248519 60.28 60
downstream ENSMUSE00000560931 Chr16:22247263..22247336 GATCGTGATCGAGAACGTGA Chr16:22247252..22247271 59.79 50
downstream ENSMUSE00000702638 Chr16:22246442..22246939 CACACAGGCTTCGATCTTCA Chr16:22246561..22246580 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGCCTGAAAGGAGGGAAT Chr16:22262768..22262788 60.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCGTGACTGGGAAAACC Chr16:22265746..22265766 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCACATCCGGCAGTGTTAGA Chr16:22262995..22263015 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTAGCGTGACTGGGAAAACC Chr16:22265928..22265948 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022858