Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23741
Trapped Gene
Rpl6 (ENSMUSG00000029614)
Vector Insertion
Chr 5: 121655865 - 121656675
Public Clones PST21142-NR (escells) PST17838-NR (escells)
Private Clones OST246305 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000284199 (Chr5:121655763..121655864 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGGTGAAGCTTCGAAAAA Chr5:121655843..121655862 60.23 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000284199 (Chr5:121655763..121655864 +)
Downstram Exon
ENSMUSE00000284194 (Chr5:121656676..121656819 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGGTGAAGCTTCGAAAAA Chr5:121655843..121655862 60.23 45 CTGGAGCGTAGCCTTCTCAC Chr5:121656770..121656789 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689179 Chr5:121654543..121654561 No primer for this exon
upstream ENSMUSE00000465540 Chr5:121655415..121655672 AAAGCGCCTGATACAAAGGA Chr5:121655427..121655446 59.85 45
upstream ENSMUSE00000284199 Chr5:121655763..121655864 GGTGGTGAAGCTTCGAAAAA Chr5:121655843..121655862 60.23 45

*** Putative Vector Insertion (Chr 5: 121655865 - 121656675) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000284194 Chr5:121656676..121656819 CTGGAGCGTAGCCTTCTCAC Chr5:121656770..121656789 60.16 60
downstream ENSMUSE00000190743 Chr5:121657156..121657204 GTCCAGCTGCTTCAGGAAAA Chr5:121657185..121657204 60.52 50
downstream ENSMUSE00000190744 Chr5:121658400..121658584 GGGGATTTTAACATCGCTGA Chr5:121658500..121658519 59.9 45
downstream ENSMUSE00000617922 Chr5:121658791..121658976 AAACTGAGAGCGCAGGTAGC Chr5:121658904..121658923 59.79 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGGTGAAGCTTCGAAAAA Chr5:121655844..121655864 60.23 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGGTGAAGCTTCGAAAAA Chr5:121655844..121655864 60.23 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029614