Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23742
Trapped Gene
Evc2 (ENSMUSG00000050248)
Vector Insertion
Chr 5: 37742414 - 37748638
Public Clones not available
Private Clones OST246297 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000476601 (Chr5:37742360..37742413 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTAAAAGCCCCCTTTACCA Chr5:37742371..37742390 60.43 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000476601 (Chr5:37742360..37742413 +)
Downstram Exon
ENSMUSE00000482370 (Chr5:37748639..37748773 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTAAAAGCCCCCTTTACCA Chr5:37742371..37742390 60.43 50 TGCGTGAAGACCATGGTTAG Chr5:37748668..37748687 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000506394 Chr5:37729726..37729966 GGGTCTGTAGCCACCAGATG Chr5:37729770..37729789 60.53 60
upstream ENSMUSE00000653821 Chr5:37729836..37729937 CGTGCACTTCCACCATCCTT Chr5:37729883..37729902 63.39 55
upstream ENSMUSE00000653820 Chr5:37729940..37729966 No primer for this exon
upstream ENSMUSE00000488648 Chr5:37738679..37738747 TTTCAAGAGAAGCCCGAGGT Chr5:37738689..37738708 61.26 50
upstream ENSMUSE00000477474 Chr5:37739827..37740013 CTGTCCGTGAACAACACCAG Chr5:37739866..37739885 60.19 55
upstream ENSMUSE00000546266 Chr5:37741578..37741687 CATCTTTCAGAGCCCCTCAC Chr5:37741666..37741685 59.8 55
upstream ENSMUSE00000476601 Chr5:37742360..37742413 GCTAAAAGCCCCCTTTACCA Chr5:37742371..37742390 60.43 50

*** Putative Vector Insertion (Chr 5: 37742414 - 37748638) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482370 Chr5:37748639..37748773 TGCGTGAAGACCATGGTTAG Chr5:37748668..37748687 59.72 50
downstream ENSMUSE00000479731 Chr5:37754756..37754895 CACACCGTTAGCAGAGGTGA Chr5:37754815..37754834 59.9 55
downstream ENSMUSE00000480593 Chr5:37761763..37762087 CTGATTCAGGGTTGCGATCT Chr5:37761790..37761809 60.22 50
downstream ENSMUSE00000394106 Chr5:37769422..37769661 CTCGGCTTGGTCCAGAGTAA Chr5:37769514..37769533 60.39 55
downstream ENSMUSE00000347795 Chr5:37771649..37771824 TGCTGAGATGGTATCGCTTG Chr5:37771709..37771728 59.97 50
downstream ENSMUSE00000393222 Chr5:37774317..37774476 GCTCCAATAGCGTTTCCATC Chr5:37774363..37774382 59.67 50
downstream ENSMUSE00000653819 Chr5:37774317..37774416 GCTCCAATAGCGTTTCCATC Chr5:37774363..37774382 59.67 50
downstream ENSMUSE00000367500 Chr5:37777924..37778378 CTCCAGTGCATCCTGCTGTA Chr5:37778328..37778347 60.01 55
downstream ENSMUSE00000474607 Chr5:37783232..37783436 CTTACCCGGAGCAGGTCTTC Chr5:37783288..37783307 61.14 60
downstream ENSMUSE00000463182 Chr5:37784319..37784435 No primer for this exon
downstream ENSMUSE00000395375 Chr5:37801473..37801700 GAGCCACAAGTGACTCAGCA Chr5:37801554..37801573 60.19 55
downstream ENSMUSE00000351735 Chr5:37806966..37807186 TGCCTTTCAGGATCCATCTC Chr5:37807123..37807142 60.16 50
downstream ENSMUSE00000384620 Chr5:37808644..37808731 CCATGGTGTCAGCTTCAATG Chr5:37808717..37808736 60.11 50
downstream ENSMUSE00000360345 Chr5:37810363..37810565 CTTCTCACTGACTGCGTCCA Chr5:37810500..37810519 60.18 55
downstream ENSMUSE00000395517 Chr5:37813077..37813178 GTCCAAAACCTTCCACCAAA Chr5:37813110..37813129 59.81 45
downstream ENSMUSE00000352065 Chr5:37815648..37816285 CTCTCCTGGACGGGAACATA Chr5:37815686..37815705 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTCTCTAATCGCCTTGCAG Chr5:37748458..37748479 58.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCCTTTACCATCACAGTGG Chr5:37748381..37748401 60.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050248