Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23751
Trapped Gene
Exosc7 (ENSMUSG00000025785)
Vector Insertion
Chr 9: 123022441 - 123028008
Public Clones not available
Private Clones OST246010 (lexicon) OST55799 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253316 (Chr9:123022349..123022440 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACATCGTTCATGGAGTGCAG Chr9:123022421..123022440 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253316 (Chr9:123022349..123022440 +)
Downstram Exon
ENSMUSE00000153181 (Chr9:123028009..123028110 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACATCGTTCATGGAGTGCAG Chr9:123022421..123022440 59.71 50 TTGACTCTGGCAGACCCACT Chr9:123028109..123028128 60.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000253316 Chr9:123022349..123022440 ACATCGTTCATGGAGTGCAG Chr9:123022421..123022440 59.71 50

*** Putative Vector Insertion (Chr 9: 123022441 - 123028008) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000153181 Chr9:123028009..123028110 TTGACTCTGGCAGACCCACT Chr9:123028109..123028128 60.86 55
downstream ENSMUSE00000153183 Chr9:123028359..123028453 GTTTCTCCAGCTTCGGTGTC Chr9:123028422..123028441 59.85 55
downstream ENSMUSE00000153182 Chr9:123036924..123037089 CCGGTAGAGGGTGTTAGCAA Chr9:123037005..123037024 60.12 55
downstream ENSMUSE00000153180 Chr9:123039642..123039712 CATCAAACAAATTCCCACCA Chr9:123039675..123039694 59.22 40
downstream ENSMUSE00000153178 Chr9:123039945..123040068 CATCCTCCAGAACACGAACC Chr9:123039976..123039995 60.51 55
downstream ENSMUSE00000253187 Chr9:123041003..123041158 AGGCCTCCTCTTGAAGTGTG Chr9:123041051..123041070 59.45 55
downstream ENSMUSE00000344949 Chr9:123045017..123045247 CAACGTGCAGTGGAGAGAAA Chr9:123045144..123045163 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCGTTCATGGAGTGCAGGT Chr9:123022424..123022444 60.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCGTTCATGGAGTGCAGGT Chr9:123022424..123022444 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025785