Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23756
Trapped Gene
Gpr37l1 (ENSMUSG00000026424)
Vector Insertion
Chr 1: 137058273 - 137063451
Public Clones not available
Private Clones OST245900 (lexicon) OST47024 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388495 (Chr1:137063452..137064258 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGCTACTCGGGGATGTTT Chr1:137063478..137063497 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388495 (Chr1:137063452..137064258 -)
Downstram Exon
ENSMUSE00000158960 (Chr1:137056829..137058272 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGCTACTCGGGGATGTTT Chr1:137063478..137063497 59.96 50 AGCACCTAACGGGAACAATG Chr1:137056853..137056872 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000388495 Chr1:137063452..137064258 AAGGCTACTCGGGGATGTTT Chr1:137063478..137063497 59.96 50

*** Putative Vector Insertion (Chr 1: 137058273 - 137063451) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158960 Chr1:137056829..137058272 AGCACCTAACGGGAACAATG Chr1:137056853..137056872 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr1:137060381..137060401 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATAGGCAAGCATTCTGCTG Chr1:137060415..137060435 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026424