Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23763
Trapped Gene
E130309D14Rik (ENSMUSG00000069814)
Vector Insertion
Chr 11: 74443614 - 74448742
Public Clones not available
Private Clones OST245715 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000578455 (Chr11:74443461..74443613 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCCTGAAAAAGGAGCAG Chr11:74443536..74443555 59.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000578455 (Chr11:74443461..74443613 +)
Downstram Exon
ENSMUSE00000578454 (Chr11:74448743..74448790 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCCTGAAAAAGGAGCAG Chr11:74443536..74443555 59.19 50 CTCTCTCATCTCCAGGTCGTG Chr11:74448773..74448793 59.99 57.14

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000578456 Chr11:74433107..74433348 TCACGTTGCTGGGTGTTTAC Chr11:74433122..74433141 59.62 50
upstream ENSMUSE00000719478 Chr11:74433107..74433348 TCACGTTGCTGGGTGTTTAC Chr11:74433122..74433141 59.62 50
upstream ENSMUSE00000578455 Chr11:74443461..74443613 GCTTCCTGAAAAAGGAGCAG Chr11:74443536..74443555 59.19 50

*** Putative Vector Insertion (Chr 11: 74443614 - 74448742) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000578454 Chr11:74448743..74448790 CTCTCTCATCTCCAGGTCGTG Chr11:74448773..74448793 59.99 57.14
downstream ENSMUSE00000676832 Chr11:74448885..74448925 CCTTCTTCTGGAGTGTCTGAAG Chr11:74448926..74448947 58.19 50
downstream ENSMUSE00000676831 Chr11:74449404..74449431 CGGCCCAAGTGAGACTTAAA Chr11:74449429..74449448 60.24 50
downstream ENSMUSE00000676830 Chr11:74449523..74449559 No primer for this exon
downstream ENSMUSE00000676829 Chr11:74450111..74450141 CCTCCCTCCTGAAACAATGA Chr11:74450138..74450157 60.04 50
downstream ENSMUSE00000676828 Chr11:74450802..74450811 No primer for this exon
downstream ENSMUSE00000676827 Chr11:74450889..74450903 No primer for this exon
downstream ENSMUSE00000676826 Chr11:74451319..74451339 GGCGCAGCGTAGTAAATAATC Chr11:74451341..74451361 58.93 47.62
downstream ENSMUSE00000650861 Chr11:74451460..74455018 AGGTGGGACAGGTATTGCAG Chr11:74453664..74453683 59.99 55
downstream ENSMUSE00000650863 Chr11:74451587..74452290 TTACTGCCAGTCCACCACAA Chr11:74452293..74452312 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATCCTGAGGCTGCAGAAA Chr11:74443585..74443605 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATCCTGAGGCTGCAGAAA Chr11:74443585..74443605 60.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069814