Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23795
Trapped Gene
Rps24 (ENSMUSG00000025290)
Vector Insertion
Chr 14: 25311038 - 25311128
Public Clones not available
Private Clones OST244654 (lexicon) OST184495 (lexicon) OST8039 (lexicon) OST1031 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000619464 (Chr14:25310972..25311037 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAACCGTCTGCTTCAGAG Chr14:25311008..25311027 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000619464 (Chr14:25310972..25311037 +)
Downstram Exon
ENSMUSE00000619463 (Chr14:25311129..25311338 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAACCGTCTGCTTCAGAG Chr14:25311008..25311027 60.44 55 TCCCGAATTTCTGTCTTTGG Chr14:25311187..25311206 60.04 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691481 Chr14:25309940..25309980 TCTTTTCCTCCTCTCCAGCTC Chr14:25309941..25309961 60.08 52.38
upstream ENSMUSE00000619464 Chr14:25310972..25311037 ACCAACCGTCTGCTTCAGAG Chr14:25311008..25311027 60.44 55

*** Putative Vector Insertion (Chr 14: 25311038 - 25311128) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000619463 Chr14:25311129..25311338 TCCCGAATTTCTGTCTTTGG Chr14:25311187..25311206 60.04 45
downstream ENSMUSE00000619462 Chr14:25312605..25312715 GCTGTTTTCGGGAGGTCTTT Chr14:25312647..25312666 60.61 50
downstream ENSMUSE00000691466 Chr14:25312839..25312841 No primer for this exon
downstream ENSMUSE00000691469 Chr14:25314652..25314671 No primer for this exon
downstream ENSMUSE00000650494 Chr14:25314997..25315067 AAACATCAAGTCACCGCAGA Chr14:25315032..25315051 59.29 45
downstream ENSMUSE00000691468 Chr14:25314997..25315067 AAACATCAAGTCACCGCAGA Chr14:25315032..25315051 59.29 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr14:25311087..25311107 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000025290