Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23796
Trapped Gene
Ppp1r2 (ENSMUSG00000047714)
Vector Insertion
Chr 16: 31274931 - 31275079
Public Clones not available
Private Clones OST244627 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000466452 (Chr16:31274932..31275363 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGATCGTGGAAGAGGAACTG Chr16:31274934..31274953 60.79 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000466452 (Chr16:31274932..31275363 -)
Downstram Exon
ENSMUSE00000652940 (Chr16:31274932..31275078 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGATCGTGGAAGAGGAACTG Chr16:31274934..31274953 60.79 55 CGCAGAGGTCTTGTTCTTCA Chr16:31274972..31274991 59.16 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466452 Chr16:31274932..31275363 CGATCGTGGAAGAGGAACTG Chr16:31274934..31274953 60.79 55
upstream ENSMUSE00000652940 Chr16:31274932..31275078 CGATCGTGGAAGAGGAACTG Chr16:31274934..31274953 60.79 55

*** Putative Vector Insertion (Chr 16: 31274931 - 31275079) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000423486 Chr16:31265391..31265498 GGGATGATATGTTGCCAGGA Chr16:31265425..31265444 60.69 50
downstream ENSMUSE00000423475 Chr16:31261316..31261393 TAGGCGTCTTCATCGTCACC Chr16:31261345..31261364 61.21 55
downstream ENSMUSE00000423470 Chr16:31260660..31260754 CTCCCGAGTCCGATACTTTG Chr16:31260687..31260706 59.69 55
downstream ENSMUSE00000423462 Chr16:31258423..31258590 TTCATGCTGTCTCCATCTGC Chr16:31258421..31258440 59.95 50
downstream ENSMUSE00000702118 Chr16:31258061..31258590 AGCACAGGAGGCACTGTCTT Chr16:31258335..31258354 60.06 55
downstream ENSMUSE00000339230 Chr16:31251627..31254819 ACCCACCTCCATGGTTACAA Chr16:31252200..31252219 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000047714