Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI23800
Trapped Gene
Nradd (ENSMUSG00000032491)
Vector Insertion
Chr 9: 110524766 - 110525590
Public Clones not available
Private Clones OST244500 (lexicon) OST109279 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000346673 (Chr9:110525591..110525739 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAACGTCAGCAAAGGTGTGG Chr9:110525600..110525619 59.76 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000346673 (Chr9:110525591..110525739 -)
Downstram Exon
ENSMUSE00000446483 (Chr9:110524576..110524765 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAACGTCAGCAAAGGTGTGG Chr9:110525600..110525619 59.76 50 ACATAGGCCAGCAGACCAAG Chr9:110524566..110524585 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404326 Chr9:110526819..110526882 ACTCCCGTCGTCTTCCTAGC Chr9:110526859..110526878 60.79 60
upstream ENSMUSE00000346673 Chr9:110525591..110525739 TAACGTCAGCAAAGGTGTGG Chr9:110525600..110525619 59.76 50

*** Putative Vector Insertion (Chr 9: 110524766 - 110525590) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000446483 Chr9:110524576..110524765 ACATAGGCCAGCAGACCAAG Chr9:110524566..110524585 60.28 55
downstream ENSMUSE00000220085 Chr9:110524344..110524486 GAGGAGAGTCCACGAAGACG Chr9:110524352..110524371 59.99 60
downstream ENSMUSE00000496245 Chr9:110523642..110524241 ATAGGCTGGCATTTGGTCAC Chr9:110524041..110524060 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCCTAGGTAGCGGGCAGAT Chr9:110525549..110525569 60.08 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCCTAGGTAGCGGGCAGAT Chr9:110525549..110525569 60.08 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032491